View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4517_low_4 (Length: 271)
Name: NF4517_low_4
Description: NF4517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4517_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 16 - 261
Target Start/End: Complemental strand, 3100280 - 3100035
Alignment:
| Q |
16 |
gtataattatcacctcataaccggnnnnnnnnggccatcttcgtatttaaatgttggttacattcatcgtttttctttccagcttgctcaaagttgacat |
115 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3100280 |
gtataattatcacctcataaccggttttttttggctatcttcgtatttaaatgttggttacattcatcgtttttctttccagcttgcacaaagttgacat |
3100181 |
T |
 |
| Q |
116 |
gttcgtcttatttactaaactactaaagtacccgacaaggactacttgacaagtcatagagcgtgtttgattatataatttggatttgggaatgagctta |
215 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3100180 |
gttcgtcgtatttactaaactactaaggtacccgacaagtactacttgacaagtcatagagcgtgtttgattatataatttggatttgggaatgagctta |
3100081 |
T |
 |
| Q |
216 |
gtttacgtaatactacaagagtnnnnnnntgttgttgaaacctatg |
261 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
3100080 |
gtttacctaatactacaagagtaaaaaaatgttgttgaaacctatg |
3100035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University