View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4517_low_5 (Length: 241)
Name: NF4517_low_5
Description: NF4517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4517_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 38 - 227
Target Start/End: Complemental strand, 36230116 - 36229926
Alignment:
| Q |
38 |
ctaattttcattatggttcttaaagaatctatacaaattaatttcgagattattgagtatcaaaacnnnnnnnnataataataataaaagggtc-ttcat |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
36230116 |
ctaattttcattatggttcttaaagaatctatacaaattaatttcgagattatagagtatcaaaacctttttttataataataataaaagggtccttcat |
36230017 |
T |
|
| Q |
137 |
aaagaagtaatgcgaatcggtcgatttcaaatcaatgatcaagactaatcatatggaatccaaatccttaaactgcaatgttggtcatacc |
227 |
Q |
| |
|
||||| |||||| |||| ||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36230016 |
aaagatgtaatgtgaatgggtcgatttcaaatcgatgatcaagattaatcatatggaatccaaatccttaaactgcaatgttggtcatacc |
36229926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 63 - 102
Target Start/End: Complemental strand, 10749181 - 10749142
Alignment:
| Q |
63 |
aatctatacaaattaatttcgagattattgagtatcaaaa |
102 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
10749181 |
aatctataaaaattaatttctagattattgagtatcaaaa |
10749142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University