View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4518_low_17 (Length: 221)
Name: NF4518_low_17
Description: NF4518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4518_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 17 - 199
Target Start/End: Original strand, 7479188 - 7479370
Alignment:
| Q |
17 |
tggatgtggcttccaatgagcaacatctaataatagcatatcttttattataagttatttctataaaaatatgtgttaccttttgtaacaaattacgcat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7479188 |
tggatgtggcttccaatgagcaacatctaataatagcatatcttttattataagttatttctataaaaatatgtgttaccttttgtaaaaaattacgcat |
7479287 |
T |
 |
| Q |
117 |
tattattaaaaagaaattcaatagttgacnnnnnnnttattgcttgccttattttaattggttttgtcttgatttaaaaagat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7479288 |
tattattaaaaagaaattcaatagttgacaaaaaaattattgcttgccttattttaattggttttgtcttgatttaaaaagat |
7479370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University