View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4518_low_18 (Length: 213)
Name: NF4518_low_18
Description: NF4518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4518_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 70 - 204
Target Start/End: Complemental strand, 47618054 - 47617920
Alignment:
| Q |
70 |
tgtatatactagggtgtctaagattctttaaaatgaactacaaaaacatactatggattatagaatctaaaacgggtaactttgttnnnnnnnngtgaat |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
47618054 |
tgtatatactagggtgtctaagattctttaaaatgaactacaaaaacatactatggattatagaatctaaaacggataactttgttaaaaaaaagtgaat |
47617955 |
T |
|
| Q |
170 |
tgatttaggagaggttcaaatgatttagatgatgt |
204 |
Q |
| |
|
||| ||||||||||||||||| ||||| ||||||| |
|
|
| T |
47617954 |
tgacttaggagaggttcaaataatttatatgatgt |
47617920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University