View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4518_low_20 (Length: 210)
Name: NF4518_low_20
Description: NF4518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4518_low_20 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 10 - 210
Target Start/End: Complemental strand, 50249604 - 50249404
Alignment:
| Q |
10 |
cggacttgagttcatatgttttatttgttttctatgtttacagttttcaattcttgtgaaaagtgaatgttagtttataaatataaaattgattttgttt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50249604 |
cggacttgagttcatatgttttatttgttttctatgtttacagtttccaattcttgtgaaaagtgaatgttagtttataaatataaaattgattttgttt |
50249505 |
T |
 |
| Q |
110 |
atcattcgatatatttgatgttctcaagatttcaactcatgttaggatttgatgtttccacttccgtgtagagaaaatagttctcgggtaaactcagttt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50249504 |
atcattcgatatatttgatgttctcaagatttcaactcatgttaggatttgatgtttccacttccgtgtagagaaaatagttctcgggtaaactcagttt |
50249405 |
T |
 |
| Q |
210 |
t |
210 |
Q |
| |
|
| |
|
|
| T |
50249404 |
t |
50249404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 117 - 188
Target Start/End: Original strand, 50662053 - 50662124
Alignment:
| Q |
117 |
gatatatttgatgttctcaagatttcaactcatgttaggatttgatgtttccacttccgtgtagagaaaata |
188 |
Q |
| |
|
||||||||| |||| |||| ||||||||||| ||||||||||| |||||||| |||| | |||||||||| |
|
|
| T |
50662053 |
gatatatttcgtgttttcaatatttcaactcaagttaggatttggtgtttccatttccataaagagaaaata |
50662124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University