View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4519-Insertion-10 (Length: 46)
Name: NF4519-Insertion-10
Description: NF4519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4519-Insertion-10 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 40; Significance: 0.00000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000001
Query Start/End: Original strand, 7 - 46
Target Start/End: Complemental strand, 45793432 - 45793393
Alignment:
| Q |
7 |
aaaatttgtaagtttaactatttgatttcatcccttcccc |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45793432 |
aaaatttgtaagtttaactatttgatttcatcccttcccc |
45793393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University