View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4519-Insertion-9 (Length: 163)
Name: NF4519-Insertion-9
Description: NF4519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4519-Insertion-9 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 8e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 8e-81
Query Start/End: Original strand, 8 - 163
Target Start/End: Original strand, 12344114 - 12344269
Alignment:
| Q |
8 |
caaacaacaacacttcaaataacctcattcatcatcatcacttccaaaatagtggaaataataatgcaaacaacccttatcaatcttttcatcaaaataa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12344114 |
caaacaacaacacttcaaataacctcattcatcatcatcacttccaaaatagtggaaataataatgcaaacaacccttatcaatcttttcatcaaaataa |
12344213 |
T |
|
| Q |
108 |
ttactttcaacacccccatccccaaccactctttcaacaccacctgccacatcaac |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12344214 |
ttactttcaacacccccatccccaaccactctttcaacaccaccagccacatcaac |
12344269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University