View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4519_high_10 (Length: 334)
Name: NF4519_high_10
Description: NF4519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4519_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 321
Target Start/End: Complemental strand, 2083548 - 2083226
Alignment:
| Q |
1 |
aagcatctgattatggttttaggcatgcaatactgtgtacatatgctgtagtggattagtctctcaagtttcagtttcagctagactagtgtaaagttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2083548 |
aagcatctgattatggttttaggcatgcaatactgtgtgcatgtgctgtagtggattagtctctcaagtttcagtttcagctagactagtgtaaagttga |
2083449 |
T |
 |
| Q |
101 |
ttttcgaataattgcatttgg-acacaacattgcaaagatgggggtgtgtgtaaactggtaacaatgtgccctttttcatattgttgtttttgataactt |
199 |
Q |
| |
|
|||| |||||||||||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2083448 |
tttttgaataattgcatttggaacaaaacattgcaaagat-ggggtgtgtgtaaactggtaacaatgtgccctttttcatattgttgtttttgataactt |
2083350 |
T |
 |
| Q |
200 |
tattgtaaatttgcctcaattttatggtttactgatctgttatgta-tgtttggaggaatttcatcgtgcttttgattaatggga-nnnnnnnngtcctc |
297 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
2083349 |
tattgtaaatttgcctcaattttatggcttactgatctgttatgtattgtttggaggaatttcattgtgcttttgattaatgggatttttttttgtcctc |
2083250 |
T |
 |
| Q |
298 |
caaatcaagctttcgactcaacct |
321 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
2083249 |
caaatcaagctttcgactcaacct |
2083226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University