View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4519_high_14 (Length: 278)
Name: NF4519_high_14
Description: NF4519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4519_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 11 - 259
Target Start/End: Complemental strand, 4549587 - 4549339
Alignment:
| Q |
11 |
cacagaccaaattacctcggcaaggaagatactttcgtctgttcaaattgatcaagatctcaaggtgaaaatctctagggtgtgtgcggagttgaatgtg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4549587 |
cacagaccaaattacctcggcaaggaagatactttcgtctgttcaaattgatcaagatctcaaggtgaaaatctctagggtgtgtgcagagttgaatgtg |
4549488 |
T |
|
| Q |
111 |
gatggattgagaggagacatagtatcaaacagagctgctaaagctttggcagctctaaagggaagagaccaagtgactgtagaggatattgctactgtca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4549487 |
gatggattgagaggagacatagtatcaaacagagctgctaaagctttggctgctctaaagggaagagaccaagtgactgtagaggatattgctactgtca |
4549388 |
T |
|
| Q |
211 |
tccctaactgcttgagacaccgtcttagaaaggatcctttggagtcaat |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4549387 |
tccctaactgcttgagacaccgtcttagaaaggatcctttggagtcaat |
4549339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 87; Significance: 9e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 18 - 256
Target Start/End: Original strand, 34590696 - 34590934
Alignment:
| Q |
18 |
caaattacctcggcaaggaagatactttcgtctgttcaaattgatcaagatctcaaggtgaaaatctctagggtgtgtgcggagttgaatgtggatggat |
117 |
Q |
| |
|
||||||||| | |||||||| | ||| | ||||||||||| ||||| || || ||||||||||| || | ||| ||||| ||||||||||||||||||| |
|
|
| T |
34590696 |
caaattaccgcagcaaggaattttcttgcttctgttcaaatagatcatgaacttaaggtgaaaatttccaaggtttgtgcagagttgaatgtggatggat |
34590795 |
T |
|
| Q |
118 |
tgagaggagacatagtatcaaacagagctgctaaagctttggcagctctaaagggaagagaccaagtgactgtagaggatattgctactgtcatccctaa |
217 |
Q |
| |
|
| ||||| ||||| ||| |||| |||||||| |||||| | || | || ||||||| | || |||| | || ||||||||||||||||||||| ||||| |
|
|
| T |
34590796 |
taagaggtgacattgtaacaaatagagctgcaaaagctcttgctggcctcaagggaataaacaaagtaagtgcagaggatattgctactgtcattcctaa |
34590895 |
T |
|
| Q |
218 |
ctgcttgagacaccgtcttagaaaggatcctttggagtc |
256 |
Q |
| |
|
||| ||||||||||||||| |||||||||| |||||||| |
|
|
| T |
34590896 |
ctgtttgagacaccgtcttcgaaaggatccattggagtc |
34590934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University