View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4519_high_25 (Length: 209)

Name: NF4519_high_25
Description: NF4519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4519_high_25
NF4519_high_25
[»] chr8 (1 HSPs)
chr8 (7-191)||(35241158-35241342)


Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 7 - 191
Target Start/End: Original strand, 35241158 - 35241342
Alignment:
7 cttcttgaattaatgtgcttactctttgataccctgaatttttatttgttgtgaattgttgaattctcaattgttttcttttaatcannnnnnnnnnnna 106  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||            |    
35241158 cttcttgaattaatgtgcttactctttgataccctaaatttttatttgttgtgaattgttgaattctcaattgttttcttttaatcatttttttttttga 35241257  T
107 tttgaccagcctcgggaggacatgcatatttgtatgaaccttggtggtggattggaatgatctcaagtatgtgattttgcaggtt 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35241258 tttgaccagcctcgggaggacatgcatatttgtatgaaccttggtggtggattggaatgatctcaagtatgtgattttgcaggtt 35241342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University