View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4519_low_1 (Length: 804)
Name: NF4519_low_1
Description: NF4519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4519_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 474; Significance: 0; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 474; E-Value: 0
Query Start/End: Original strand, 17 - 549
Target Start/End: Original strand, 9502556 - 9503093
Alignment:
| Q |
17 |
cataggctgtaggaaggaaatggaggatgcggtgagtgtggggataggttttacgatgaaggatggagagaagtgtgatttcttcggtgtttatgatggt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9502556 |
cataggctgtaggaaggaaatggaggatgcggtgagtatggagataggttttacgatgaaggatggagagaagtgtgatttcttcggtgtttatgatggt |
9502655 |
T |
 |
| Q |
117 |
cacggtggtgctcaggtggcggtgtcgtgtagagagaggttgtataggattgtggcggaggaggtcgagatgtgttgggaggatagggaatgggattggg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
9502656 |
cacggtggtgctcaggtggcggtgtcgtgtagagagaggttgtataggattgtggcggaggaggttgagatgttttgggaggatagggaatgggattggg |
9502755 |
T |
 |
| Q |
217 |
agagggtgatggaagggtgttttggtaaaatggatagggaggtggcgggtgatgccgcggttaggaccgtgggatccacggctgttgtggcggttgttgt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9502756 |
agagggtgatggaagggtgttttggtaaaatggatagggaggtggcgggtgatgccacggttaggaccgtgggatccacggctgttgtggcggttgttgt |
9502855 |
T |
 |
| Q |
317 |
taaagaggagattgttgttgcgaattgtggtgattctagagccgttttgggacgaggtggtgaagtcgtggagttgtcttctgatcataag-----gtag |
411 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9502856 |
taaagaggagattgttgttgcgaattgtggtgattctagagccgttttgggacgaggtggtgaagtcgtggagttgtcttctgatcataaggtactgtag |
9502955 |
T |
 |
| Q |
412 |
tactatatttgattttcttaatatatttgatagtactaatttctaggcagtatacaactagatagataattggatgctttgatcatgtgctcgatttctg |
511 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |||||||| |
|
|
| T |
9502956 |
tactatatttgattttcttaatatatttgatagtactaatttctaggcagtatacaactagatagataattggatgctctcatcatgtgcttgatttctg |
9503055 |
T |
 |
| Q |
512 |
actgatgcgtatgaaaaatatatatagtcacgccgaga |
549 |
Q |
| |
|
||||||| |||||||||| |||||||||||| |||||| |
|
|
| T |
9503056 |
actgatgtgtatgaaaaacatatatagtcacaccgaga |
9503093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 712 - 788
Target Start/End: Original strand, 9503211 - 9503287
Alignment:
| Q |
712 |
aagtagataaagtttttcattccaaagaaaactattgtatgataatgaatgaatgtaatattgatttccttgtttgt |
788 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9503211 |
aagtagataaattttttcattccaaagaaaactattgtatgataatgaatgaaggtaatattgatttccttgtttgt |
9503287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 585 - 634
Target Start/End: Original strand, 9503093 - 9503142
Alignment:
| Q |
585 |
attgcagcaaaatgcaatatctatacattgttgcatctagattctagagt |
634 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9503093 |
attgcagcaaattgcaatatctatacattgttgcatctagattctagagt |
9503142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University