View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4520-Insertion-7 (Length: 208)
Name: NF4520-Insertion-7
Description: NF4520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4520-Insertion-7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 8 - 208
Target Start/End: Complemental strand, 4817820 - 4817620
Alignment:
| Q |
8 |
gcttcatagattcatgttaaaaaatatgcgcgtaccttcaatgaactcggtcaatctggtgatgaattgggtgcgacatgtgtcacagtaaacaacacct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4817820 |
gcttcatagattcatgttaaaaaatatgtacgtaccttcaatgaactcggtcaatctggtgatgaattgggtgcgacatgtgtcacagtaaacaacacct |
4817721 |
T |
|
| Q |
108 |
tctacaaagaagcgatcagacttggaataagccgaacctaagaaggataaaaagcaaagggtgaagacaagggggattgtagactttgccattgttcttg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4817720 |
tctacaaagaagcgatcagacttggaataagccgaacctaagaaggataaaaagcaaagggtgaagacaagggggattgtagactttgccattgttcttg |
4817621 |
T |
|
| Q |
208 |
a |
208 |
Q |
| |
|
| |
|
|
| T |
4817620 |
a |
4817620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University