View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4520-Insertion-8 (Length: 117)
Name: NF4520-Insertion-8
Description: NF4520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4520-Insertion-8 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 2e-53; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 8 - 117
Target Start/End: Original strand, 15441171 - 15441280
Alignment:
| Q |
8 |
ataattgattcagaaaaaggtgaagtcgattccagcaaaggatgtgcaactgctgttactattgctgatccacaacctatttctgatccaatctggaggt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15441171 |
ataattgattcagaaaaaggtgaagtcgattccagcaaaggatgtgcaactgctgttactattgctgatccacaacctatttctgatccaatctggaggt |
15441270 |
T |
|
| Q |
108 |
aataaatttg |
117 |
Q |
| |
|
|| ||||||| |
|
|
| T |
15441271 |
aagaaatttg |
15441280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University