View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4520_high_10 (Length: 332)
Name: NF4520_high_10
Description: NF4520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4520_high_10 |
 |  |
|
| [»] scaffold0460 (2 HSPs) |
 |  |  |
|
| [»] scaffold1185 (1 HSPs) |
 |  |  |
|
| [»] scaffold0445 (1 HSPs) |
 |  |  |
|
| [»] scaffold0608 (1 HSPs) |
 |  |  |
|
| [»] scaffold0707 (1 HSPs) |
 |  |  |
|
| [»] scaffold0128 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold0275 (1 HSPs) |
 |  |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0690 (1 HSPs) |
 |  |  |
|
| [»] scaffold0288 (1 HSPs) |
 |  |  |
|
| [»] scaffold0157 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (2 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
| [»] scaffold0100 (1 HSPs) |
 |  |  |
|
| [»] scaffold1372 (1 HSPs) |
 |  |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
| [»] scaffold1787 (1 HSPs) |
 |  |  |
|
| [»] scaffold0864 (2 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold0394 (1 HSPs) |
 |  |  |
|
| [»] scaffold0258 (1 HSPs) |
 |  |  |
|
| [»] scaffold0254 (1 HSPs) |
 |  |  |
|
| [»] scaffold0330 (1 HSPs) |
 |  |  |
|
| [»] scaffold0199 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold1709 (1 HSPs) |
 |  |  |
|
| [»] scaffold1331 (1 HSPs) |
 |  |  |
|
| [»] scaffold0063 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0250 (1 HSPs) |
 |  |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
| [»] scaffold0517 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0460 (Bit Score: 57; Significance: 9e-24; HSPs: 2)
Name: scaffold0460
Description:
Target: scaffold0460; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 161 - 217
Target Start/End: Original strand, 12456 - 12512
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12456 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgg |
12512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 13263 - 13226
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13263 |
tagctcagttggtagggatattgcatattatatgcagg |
13226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1185 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: scaffold1185
Description:
Target: scaffold1185; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 160 - 213
Target Start/End: Complemental strand, 2447 - 2394
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2447 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
2394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 178)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 161 - 217
Target Start/End: Original strand, 1937307 - 1937363
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgg |
217 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1937307 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcgg |
1937363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 161 - 218
Target Start/End: Complemental strand, 94584 - 94527
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgga |
218 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
94584 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgga |
94527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 164 - 217
Target Start/End: Complemental strand, 34158727 - 34158674
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgg |
217 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34158727 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcgg |
34158674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 10736947 - 10736895
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10736947 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
10736895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 11875883 - 11875935
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11875883 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
11875935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 11890890 - 11890942
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11890890 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
11890942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 17698519 - 17698571
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17698519 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
17698571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 29716857 - 29716909
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29716857 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
29716909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 34413059 - 34413111
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34413059 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
34413111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 38219641 - 38219589
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38219641 |
atccccgtgagcatagctcagttggtagggatattgcatattatatgcaggag |
38219589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 35939483 - 35939534
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35939483 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
35939534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 12298 - 12248
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12298 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
12248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 8265265 - 8265315
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8265265 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
8265315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 16449122 - 16449172
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16449122 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
16449172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 26022244 - 26022294
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26022244 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
26022294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 32719680 - 32719630
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32719680 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
32719630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 41689879 - 41689929
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41689879 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
41689929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 160 - 213
Target Start/End: Original strand, 6280476 - 6280529
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6280476 |
catccccgtgagcttagctcagttggtagggatattgaatattatatgcaggag |
6280529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 162 - 211
Target Start/End: Complemental strand, 23178963 - 23178914
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23178963 |
tccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
23178914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 161 - 210
Target Start/End: Original strand, 39362262 - 39362311
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39362262 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcag |
39362311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 133412 - 133464
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
133412 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgcaggag |
133464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 2787150 - 2787102
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2787150 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
2787102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 6659286 - 6659338
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6659286 |
atccccgtgagattagctcagttggtagggatattgcatattatatgcaggag |
6659338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 6739688 - 6739740
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6739688 |
atccccgtgagattagctcagttggtagggatattgcatattatatgcaggag |
6739740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 14876675 - 14876623
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14876675 |
atccccgtgagcttagctcagttggtagggaaattgcatattatatgcaggag |
14876623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 17027953 - 17027901
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17027953 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgccggag |
17027901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 17558389 - 17558337
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17558389 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgccggag |
17558337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 26567321 - 26567269
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26567321 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgcaggag |
26567269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 28909462 - 28909514
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28909462 |
atccccgtgagcttagctcagttggtagggatattgcatattacatgcaggag |
28909514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 29514623 - 29514675
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29514623 |
atccccgtgagcttagctcagttggtagggatattgtatattatatgcaggag |
29514675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 30972890 - 30972838
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30972890 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgccggag |
30972838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 34266009 - 34266061
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34266009 |
atccccgcgagcttagctcagttggtagggatattgcatattatatgcaggag |
34266061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 37717360 - 37717412
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37717360 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggag |
37717412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 43284039 - 43283987
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43284039 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcaggag |
43283987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 23858193 - 23858244
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23858193 |
catctccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
23858244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 33617968 - 33618019
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33617968 |
catccccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
33618019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 44340421 - 44340374
Alignment:
| Q |
158 |
gacatccccgtgagcgtagctcagttggtagggatattgcatattata |
205 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44340421 |
gacatccccgtgagcttagctcagttggtagggatattgcatattata |
44340374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 2792776 - 2792826
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2792776 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgcagg |
2792826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 3190022 - 3189972
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3190022 |
atccccgtgtgcatagctcagttggtagggatattgcatattatatgcagg |
3189972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 8034485 - 8034435
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8034485 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
8034435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 20540179 - 20540129
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
20540179 |
atccccgtgagcttagctcagttgttagggatattgcatattatatgcagg |
20540129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 34894366 - 34894416
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34894366 |
atccccgtaagcttagctcagttggtagggatattgcatattatatgcagg |
34894416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 159 - 213
Target Start/End: Complemental strand, 38620416 - 38620362
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38620416 |
acatccctgtgagcttagctcagttggtagggatattgtatattatatgcaggag |
38620362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 42006781 - 42006827
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42006781 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggag |
42006827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 207
Target Start/End: Original strand, 43656033 - 43656079
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43656033 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
43656079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 11483120 - 11483169
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
11483120 |
cccgtgagcgtagctcagttagtaggaatattgcatattatatgcaggag |
11483169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 218
Target Start/End: Original strand, 13406601 - 13406654
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgga |
218 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13406601 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcaggagccgga |
13406654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 34472297 - 34472346
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34472297 |
cccgtgagcttaactcagttggtagggatattgcatattatatgcaggag |
34472346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 160 - 213
Target Start/End: Original strand, 42880944 - 42880997
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42880944 |
catccccgtgagcttaactcagttggtagggatattgcatattatatgtaggag |
42880997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 7797127 - 7797179
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7797127 |
atccccgtaagcttagctcagttggtagggatattgaatattatatgcaggag |
7797179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 7816400 - 7816452
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7816400 |
atccccgtaagcttagctcagttggtagggatattgaatattatatgcaggag |
7816452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 10200754 - 10200702
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||| ||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10200754 |
atcctcgtgagcttagctcagttggtagagatattgcatattatatgcaggag |
10200702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 16432197 - 16432149
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16432197 |
ccgtgaacttagctcagttggtagggatattgcatattatatgcaggag |
16432149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 23435306 - 23435254
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||| |||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23435306 |
atccctgtgagcttagctcagttgatagggatattgcatattatatgcaggag |
23435254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 27077164 - 27077120
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27077164 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
27077120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 31451026 - 31450978
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31451026 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcaggag |
31450978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 43186850 - 43186902
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43186850 |
atccgcgtgagtttagctcagttggtagggatattgcatattatatgcaggag |
43186902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 174 - 213
Target Start/End: Complemental strand, 22274671 - 22274632
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22274671 |
tagctcagttggtagggatattgcatattatatgcaggag |
22274632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 38344051 - 38344098
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38344051 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggag |
38344098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 40362048 - 40362095
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40362048 |
cccgtgagcttagctcagttagtagggatattgcatattatatgcagg |
40362095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 211
Target Start/End: Complemental strand, 41616440 - 41616389
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||| |||||||||||||| |
|
|
| T |
41616440 |
catccccgtgagcataactcagttggtagggatattgtatattatatgcagg |
41616389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 257536 - 257586
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
257536 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
257586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 658384 - 658334
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
658384 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
658334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 844120 - 844070
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
844120 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
844070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 213
Target Start/End: Complemental strand, 4615747 - 4615697
Alignment:
| Q |
163 |
ccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4615747 |
ccccgtgagtttagttcagttggtagggatattgcatattatatgcaggag |
4615697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 5328640 - 5328590
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| || ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5328640 |
atccctgtaagcttagctcagttggtagggatattgcatattatatgcagg |
5328590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 7388452 - 7388502
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| | || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7388452 |
atccccgtgaacttaactcagttggtagggatattgcatattatatgcagg |
7388502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 10083164 - 10083210
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10083164 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
10083210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 10568082 - 10568132
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10568082 |
atccccgtgagtttagctcagttggtagggatattgcatattaaatgcagg |
10568132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 17072636 - 17072586
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
17072636 |
atccccgtgagcttagcacagttggtaggtatattgcatattatatgcagg |
17072586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 17575635 - 17575685
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
17575635 |
atccccgtgagcttagcacagttggtaggtatattgcatattatatgcagg |
17575685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 24296937 - 24296891
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24296937 |
ccgtgagcttagctcagttagtagggatattgcatattatatgcagg |
24296891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 24458314 - 24458364
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
24458314 |
atccccgtgagcttagctcagttggaagggatattgtatattatatgcagg |
24458364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 36540284 - 36540334
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36540284 |
atccccgtgagcttaactcagttggtagggatattgcattttatatgcagg |
36540334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 38955267 - 38955217
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38955267 |
atccccgtgagcttaactcagttggtagggatattacatattatatgcagg |
38955217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 161 - 210
Target Start/End: Complemental strand, 5326243 - 5326194
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
5326243 |
atccccgtgagcttagctcagttggtagagatattgcattttatatgcag |
5326194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 7194266 - 7194311
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7194266 |
tgagcttagttcagttggtagggatattgcatattatatgcaggag |
7194311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 7765643 - 7765692
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| |||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
7765643 |
cccgtgagcttagctcagttggtatggatattacatattatatgcaggag |
7765692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 166 - 207
Target Start/End: Complemental strand, 8698648 - 8698607
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8698648 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
8698607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 174 - 211
Target Start/End: Original strand, 10573111 - 10573148
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10573111 |
tagctcagttggtagggatattgcatattatatgcagg |
10573148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 164 - 209
Target Start/End: Complemental strand, 10587347 - 10587302
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10587347 |
cccgtaagcttagctcagttggtagggatattgcatattatatgca |
10587302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 160 - 209
Target Start/End: Original strand, 28628661 - 28628710
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
28628661 |
catccccgtgagcttagctcagttggtacggatattacatattatatgca |
28628710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 38402249 - 38402298
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||| |||||| |
|
|
| T |
38402249 |
tccccgtgagcttaactcagttggtagggatattgcatattatttgcagg |
38402298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 161 - 202
Target Start/End: Complemental strand, 38745352 - 38745311
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatatt |
202 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38745352 |
atccccgtgagcttagctcagttggtagggatattgcatatt |
38745311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 41458297 - 41458342
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41458297 |
cgtgagcttaactcagttggtagggatattgcatattatatgcagg |
41458342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 8862193 - 8862149
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8862193 |
gtgagcttagctaagttggtagggatattgcatattatatgcagg |
8862149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 8953942 - 8953890
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||| ||||||| || | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8953942 |
atcctcgtgagcttaacacagttggtagggatattgcatattatatgcaggag |
8953890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 9187297 - 9187249
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgc |
208 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||| |||||||| |
|
|
| T |
9187297 |
catccccgtgagcttagctcagttggtagggatattacattttatatgc |
9187249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 13773465 - 13773413
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||| |||| ||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
13773465 |
atcccagtgaacgtagctcagttggtagagatattgcatattatatgtaggag |
13773413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 166 - 210
Target Start/End: Complemental strand, 26192784 - 26192740
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26192784 |
cgtgagcttagttcagttggtagggatattgcatattatatgcag |
26192740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 26280857 - 26280805
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
26280857 |
atccccgtgagcttaactcagttggtagggatattgcattttatatgccggag |
26280805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 28420497 - 28420445
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||| ||||||| |||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
28420497 |
atcctcgtgagcttagctcagttggtaggaatattgcatattatatgctggag |
28420445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 29260616 - 29260668
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||| ||||||| || ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29260616 |
atccacgtgagcttaactcagctggtagggatattgcatattatatgcaggag |
29260668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 37090686 - 37090634
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||| || |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37090686 |
atccccgtgagtttaactcagttggtagggatattgtatattatatgcaggag |
37090634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 43053954 - 43053906
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||| || ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43053954 |
ccgtgagcttaactcagttggtagggatatttcatattatatgcaggag |
43053906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 163 - 211
Target Start/End: Complemental strand, 43856453 - 43856405
Alignment:
| Q |
163 |
ccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43856453 |
ccccgtgagcttaactcagttggtagggatattgcattttatatgcagg |
43856405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 5570894 - 5570941
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
5570894 |
cccgtgagcttagctcagttggttgggatattgcatgttatatgcagg |
5570941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 174 - 213
Target Start/End: Complemental strand, 13647517 - 13647478
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13647517 |
tagctcagttggtagagatattgcatattatatgcaggag |
13647478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 174 - 213
Target Start/End: Complemental strand, 13747942 - 13747903
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13747942 |
tagctcagttggtagagatattgcatattatatgcaggag |
13747903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 161 - 208
Target Start/End: Original strand, 37092088 - 37092135
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgc |
208 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37092088 |
atccccgtgagtttagctcagttggtagggatattgtatattatatgc |
37092135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 39587543 - 39587594
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||| |||||| |||| |
|
|
| T |
39587543 |
catccccgtgagcttagctcagttggtagagatattgcattttatattcagg |
39587594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 1632507 - 1632461
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
1632507 |
gtgagcttagctcagttggtaggaatattacatattatatgcaggag |
1632461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 2168520 - 2168470
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||| |||||| |||| |
|
|
| T |
2168520 |
atccccgtgagcttagctcagttggtagggatattacattttatatacagg |
2168470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 207
Target Start/End: Original strand, 2590146 - 2590192
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||| ||||||| || ||||||||||||||||||||||| |
|
|
| T |
2590146 |
atccccgtgagcttagctcaattagtagggatattgcatattatatg |
2590192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 179 - 213
Target Start/End: Original strand, 5038573 - 5038607
Alignment:
| Q |
179 |
cagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
5038573 |
cagttggtagggatattgcatattatatgcaggag |
5038607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 169 - 211
Target Start/End: Complemental strand, 7764004 - 7763962
Alignment:
| Q |
169 |
gagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7764004 |
gagcttagctcagttggtagagatattgcatattatatgcagg |
7763962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 8969098 - 8969144
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||| ||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
8969098 |
gtgagcttagctaagttggtaggaatattgcatattatatgcaggag |
8969144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 10030409 - 10030459
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10030409 |
atccctgtgagtttagctcagttggtagagatattgcatattatatgcagg |
10030459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 213
Target Start/End: Complemental strand, 10594287 - 10594237
Alignment:
| Q |
163 |
ccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||| ||| | |||||||||||||||||||| ||||||||||||| |
|
|
| T |
10594287 |
ccccgtgagcttagtttagttggtagggatattgcattttatatgcaggag |
10594237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 26734069 - 26734119
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| ||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26734069 |
atccccgtaagcttagctcagttggtagatatattgcatattatatgcagg |
26734119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 29729115 - 29729165
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
29729115 |
atccccgtgagtttagttcagttggtagggatattgcatattatatacagg |
29729165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 33604245 - 33604196
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
33604245 |
atccccgtgagcttagctcagttggtagggatattg-atattacatgcagg |
33604196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 43980382 - 43980336
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| ||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
43980382 |
ccgtgagcttagttcagttgttagggatattgcatattatatgcagg |
43980336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 177 - 211
Target Start/End: Original strand, 44444557 - 44444591
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44444557 |
ctcagttggtagggatattgcatattatatgcagg |
44444591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 481009 - 481058
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||| | |||||||| |
|
|
| T |
481009 |
tccccgtgagcttagctcagttggtagggacattgcataatttatgcagg |
481058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 168 - 209
Target Start/End: Complemental strand, 4654176 - 4654135
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4654176 |
tgagcttagctcagttgctagggatattgcatattatatgca |
4654135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 7109350 - 7109313
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7109350 |
tagctcagttggtagagatattgcatattatatgcagg |
7109313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 18452355 - 18452306
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| ||||||||||| |||| |||||||||||||||| |||||| |
|
|
| T |
18452355 |
cccgtgagcttagctcagttgttaggaatattgcatattatatacaggag |
18452306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 166 - 211
Target Start/End: Complemental strand, 22437858 - 22437813
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
22437858 |
cgtgagcttagctcagttggtagggatattgcataatttatgcagg |
22437813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 169 - 210
Target Start/End: Complemental strand, 37524272 - 37524231
Alignment:
| Q |
169 |
gagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37524272 |
gagcttagctcagttggtagagatattgcatattatatgcag |
37524231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 207
Target Start/End: Complemental strand, 197131 - 197091
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
197131 |
gtgagcttagctcagttggtagggatattgcatataatatg |
197091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 207
Target Start/End: Complemental strand, 311968 - 311928
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
311968 |
gtgagcttagctcagttggtagggatattgcatataatatg |
311928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 1503907 - 1503958
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||| ||||| |||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
1503907 |
atccccatgagcttagctcagttggcagggatattg-atattatatgcaggag |
1503958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 264 - 304
Target Start/End: Complemental strand, 12936205 - 12936165
Alignment:
| Q |
264 |
aaataacctatattacagaaggtaaaacactattaaccctt |
304 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12936205 |
aaatgacctatattacaggaggtaaaacactattaaccctt |
12936165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 209
Target Start/End: Original strand, 22487876 - 22487920
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22487876 |
ccgtgagtttagctcagttggtagggatattgcattttatatgca |
22487920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 206
Target Start/End: Original strand, 28460203 - 28460243
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
28460203 |
cgtgagcttaactcagttggtagggatattgcatattatat |
28460243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 29734078 - 29734026
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||| || ||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
29734078 |
atccccgtgagtttaactcagttggtaaggatattgtatattatatgcaggag |
29734026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 164 - 208
Target Start/End: Original strand, 32258007 - 32258051
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgc |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32258007 |
cccgtgagattagctcagttggtagggatattgcatattctatgc |
32258051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 174 - 210
Target Start/End: Complemental strand, 37535559 - 37535523
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37535559 |
tagctcaattggtagggatattgcatattatatgcag |
37535523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 206
Target Start/End: Complemental strand, 3949148 - 3949109
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
3949148 |
gtgagcttaactcagttggtagggatattgcatattatat |
3949109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 9370162 - 9370215
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttg---gtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| ||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9370162 |
atccccatgagcttagctcagttgttggtagggatattgcatattatatgcagg |
9370215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 207
Target Start/End: Complemental strand, 11297063 - 11297020
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
11297063 |
cccgtgagcttagttcagttggtagggatattgcattttatatg |
11297020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 12273747 - 12273700
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| |||||||||| ||||| |||||||||||||||| |||| |
|
|
| T |
12273747 |
cccgtgagcttagctcagttagtaggaatattgcatattatatacagg |
12273700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 262 - 305
Target Start/End: Complemental strand, 25653744 - 25653701
Alignment:
| Q |
262 |
aaaaataacctatattacagaaggtaaaacactattaacccttt |
305 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25653744 |
aaaaatgacctatattacagggggtaaaacactattaacccttt |
25653701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 207
Target Start/End: Original strand, 33838324 - 33838367
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
33838324 |
cccgtgagtttagctcagttggtagggatattgcaaattatatg |
33838367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 263 - 306
Target Start/End: Complemental strand, 35839449 - 35839406
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaaccctttc |
306 |
Q |
| |
|
||||| || |||||||||| |||||||||||||||||||||||| |
|
|
| T |
35839449 |
aaaatgacatatattacaggaggtaaaacactattaaccctttc |
35839406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 37290922 - 37290969
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| || || ||||| |||||||||||||||||||||||||| |
|
|
| T |
37290922 |
cccgtgagcttaacttagttgatagggatattgcatattatatgcagg |
37290969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 40094885 - 40094932
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| ||||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
40094885 |
cccgtgagcttagctcagttgataaggatattgcattttatatgcagg |
40094932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 40740525 - 40740572
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| ||| || |||||||| |||||||||||||||||||||||||| |
|
|
| T |
40740525 |
cccgtaagcttaactcagttgatagggatattgcatattatatgcagg |
40740572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 211
Target Start/End: Complemental strand, 42877411 - 42877360
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| || | ||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
42877411 |
catccccgcgaacttagctcagttggtagagatattgtatattatatgcagg |
42877360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 44673718 - 44673671
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
44673718 |
cccgtgagcttagctcagttggtagggatatcacattttatatgcagg |
44673671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 2294172 - 2294122
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| ||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
2294172 |
atccccgtgagtttagctcaattgatagggatattacatattatatgcagg |
2294122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 3227071 - 3227022
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| ||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
3227071 |
atccccgtgagattagttcagttggtagg-atattgcatattatatgcagg |
3227022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 5332919 - 5332965
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||| ||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
5332919 |
gtgagcttagctcagttggtagagatattatatattatatgcaggag |
5332965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 207
Target Start/End: Original strand, 7453349 - 7453395
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| ||||||| |
|
|
| T |
7453349 |
atccccgtgagtttagctcagctggtagggatattgcattttatatg |
7453395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 174 - 212
Target Start/End: Original strand, 11127913 - 11127951
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagga |
212 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
11127913 |
tagctcagttggtaggaatattgcatattatatacagga |
11127951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 207
Target Start/End: Original strand, 14245143 - 14245189
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||||||| ||| | |||||||||||||||||||||||||||| |
|
|
| T |
14245143 |
atccccgtgagtttaggtaagttggtagggatattgcatattatatg |
14245189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 18926208 - 18926158
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| | ||||||| ||||||||||||| |||| ||||||||||| |
|
|
| T |
18926208 |
atccccgtgaccttagctcaattggtagggatatcgcattttatatgcagg |
18926158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 167 - 209
Target Start/End: Original strand, 18942918 - 18942960
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||| |||||||| |
|
|
| T |
18942918 |
gtgagcttagctcagttggtagggataatgcataatatatgca |
18942960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 19161964 - 19161919
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||| ||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19161964 |
ccgtaagcttagctcagttggtagg-atattgcatattatatgcagg |
19161919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 263 - 305
Target Start/End: Original strand, 23389357 - 23389399
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaacccttt |
305 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23389357 |
aaaatgacctatattacagtgggtaaaacactattaacccttt |
23389399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 263 - 305
Target Start/End: Complemental strand, 35773187 - 35773145
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaacccttt |
305 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
35773187 |
aaaatgacctatattacagagggtaaaacactattaactcttt |
35773145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 37838578 - 37838624
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||| ||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37838578 |
ccgtaagcttagctcaaatggtagggatattgcatattatatgcagg |
37838624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 263 - 305
Target Start/End: Original strand, 38711958 - 38712000
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaacccttt |
305 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38711958 |
aaaatgacctatattacagggggtaaaacactattaacccttt |
38712000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 38774072 - 38774118
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||| ||||||||||| |
|
|
| T |
38774072 |
ccgtgagcgtagcatagttggtggggatattgcattttatatgcagg |
38774118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 43085296 - 43085246
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
43085296 |
atccccgtgagcttagctcagttgggagggatatcacattttatatgcagg |
43085246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 177 - 210
Target Start/End: Complemental strand, 1286609 - 1286576
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
1286609 |
ctcaattggtagggatattgcatattatatgcag |
1286576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 161 - 210
Target Start/End: Complemental strand, 3912237 - 3912188
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||||||| || ||| ||||||||| |||||||||||||||||||| |
|
|
| T |
3912237 |
atccccgtgagtttaactcggttggtaggaatattgcatattatatgcag |
3912188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 263 - 304
Target Start/End: Original strand, 4335000 - 4335041
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaaccctt |
304 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4335000 |
aaaatgacctatattacagggggtaaaacactattaaccctt |
4335041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 211
Target Start/End: Original strand, 5683764 - 5683801
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
5683764 |
tagctcaattggtaggaatattgcatattatatgcagg |
5683801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 211
Target Start/End: Complemental strand, 13059249 - 13059200
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| |||||||||||||||||| | |||||| | |||||||| |
|
|
| T |
13059249 |
tccccgtgagcttagctcagttggtagggacaatgcataatttatgcagg |
13059200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 263 - 304
Target Start/End: Complemental strand, 13572579 - 13572538
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaaccctt |
304 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13572579 |
aaaatgacctatattacagggggtaaaacactattaaccctt |
13572538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 161 - 210
Target Start/End: Original strand, 13591816 - 13591865
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||||||| || |||||||||||||||||| |||| |||||||||| |
|
|
| T |
13591816 |
atccccgtgagtttaactcagttggtagggatatcgcattttatatgcag |
13591865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 211
Target Start/End: Original strand, 26796968 - 26797005
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
26796968 |
tagctcagttggtagggacattgcatattttatgcagg |
26797005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 207
Target Start/End: Complemental strand, 38337083 - 38337054
Alignment:
| Q |
178 |
tcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38337083 |
tcagttggtagggatattgcatattatatg |
38337054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 205
Target Start/End: Original strand, 42457133 - 42457174
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattata |
205 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
42457133 |
cccgtgagtttatctcagttggtagggatattgcatattata |
42457174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 42877032 - 42877081
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| ||||||| |||||||||| |||||||| | |||||||| |
|
|
| T |
42877032 |
tccccgtgagcttagctcaattggtagggacattgcataatttatgcagg |
42877081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 178 - 210
Target Start/End: Original strand, 6782901 - 6782933
Alignment:
| Q |
178 |
tcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
6782901 |
tcagttggtagggatattgcattttatatgcag |
6782933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 177 - 209
Target Start/End: Original strand, 19163876 - 19163908
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
19163876 |
ctcagttggtagggatattgcatataatatgca |
19163908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 20164275 - 20164231
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| || |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
20164275 |
gtgagcttaactcagttggtagagatattacatattatatgcagg |
20164231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 21470339 - 21470299
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaaccct |
303 |
Q |
| |
|
||||| |||||||||||||| |||||||||||| ||||||| |
|
|
| T |
21470339 |
aaaatgacctatattacagagggtaaaacactactaaccct |
21470299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 21470439 - 21470399
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaaccct |
303 |
Q |
| |
|
||||| |||||||||||||| |||||||||||| ||||||| |
|
|
| T |
21470439 |
aaaatgacctatattacagagggtaaaacactactaaccct |
21470399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 180 - 208
Target Start/End: Complemental strand, 21548552 - 21548524
Alignment:
| Q |
180 |
agttggtagggatattgcatattatatgc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21548552 |
agttggtagggatattgcatattatatgc |
21548524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 22202714 - 22202762
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||| || ||||||||||||||| |||||||| | |||||||||| |
|
|
| T |
22202714 |
ccgtgagcttaactcagttggtagggacattgcataatttatgcaggag |
22202762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 175 - 207
Target Start/End: Original strand, 29499589 - 29499621
Alignment:
| Q |
175 |
agctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
29499589 |
agctcagttggtagggatattgcatgttatatg |
29499621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 164 - 200
Target Start/End: Original strand, 39974841 - 39974877
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcata |
200 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
39974841 |
cccgtgagcttagctcagttggtaggaatattgcata |
39974877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 41865149 - 41865105
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| ||||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
41865149 |
gtgagcttagctcagttggtggagatattacatattatatgcagg |
41865105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 174 - 210
Target Start/End: Complemental strand, 44260249 - 44260213
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
44260249 |
tagctcagttgatagagatattgcatattatatgcag |
44260213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 147)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 31026216 - 31026268
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31026216 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
31026268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 160 - 213
Target Start/End: Complemental strand, 12640663 - 12640610
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12640663 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
12640610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 2681093 - 2681145
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2681093 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
2681145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 21388520 - 21388572
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21388520 |
atccccatgagcgtagctcagttggtagggatattgcatattatatgcaggag |
21388572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 29617402 - 29617454
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29617402 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
29617454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 35950125 - 35950177
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35950125 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
35950177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 42443686 - 42443738
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42443686 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
42443738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 44616599 - 44616651
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44616599 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
44616651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 2228972 - 2229022
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2228972 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
2229022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 9877340 - 9877290
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9877340 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
9877290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 159 - 213
Target Start/End: Original strand, 12772110 - 12772164
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12772110 |
acatcctcgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
12772164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 15238886 - 15238936
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15238886 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
15238936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 19753041 - 19752991
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19753041 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
19752991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 23102631 - 23102581
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23102631 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
23102581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 25833552 - 25833602
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25833552 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
25833602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 24781030 - 24781079
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24781030 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
24781079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 27510327 - 27510278
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27510327 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
27510278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 160 - 213
Target Start/End: Complemental strand, 33996955 - 33996902
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33996955 |
catccccgtgagtatagctcagttggtagggatattgcatattatatgcaggag |
33996902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 36391974 - 36391925
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36391974 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
36391925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 3766808 - 3766860
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3766808 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggag |
3766860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 10244962 - 10244910
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10244962 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgtaggag |
10244910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 24061402 - 24061350
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24061402 |
atccccgtgagcttagctcagttggtaggaatattgcatattatatgcaggag |
24061350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 35645596 - 35645648
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35645596 |
atccccatgagcgtagctcagttggtagggatattgtatattatatgcaggag |
35645648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 36174391 - 36174439
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36174391 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
36174439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 159 - 211
Target Start/End: Complemental strand, 38889568 - 38889516
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38889568 |
acatccccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
38889516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 46534821 - 46534769
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46534821 |
atccccatgagcttagctcagttggtagggatattgcatattatatgcaggag |
46534769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 47999777 - 47999829
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47999777 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgtaggag |
47999829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 5990218 - 5990168
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5990218 |
atccccgtgagcttagctcagttggtagggatattgtatattatatgcagg |
5990168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 27424836 - 27424886
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27424836 |
atccccgtgagcttagctcagttggaagggatattgcatattatatgcagg |
27424886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 30806112 - 30806162
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30806112 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcagg |
30806162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 207
Target Start/End: Complemental strand, 37300172 - 37300126
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37300172 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
37300126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 41084040 - 41084086
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41084040 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
41084086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 207
Target Start/End: Original strand, 47641042 - 47641088
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47641042 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
47641088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 161 - 218
Target Start/End: Original strand, 24692472 - 24692529
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgga |
218 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
24692472 |
atccccgtgaggttagctcagttggtagggatattgcatattctatgcaggagtcgga |
24692529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 166 - 211
Target Start/End: Complemental strand, 30388575 - 30388530
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30388575 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagg |
30388530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 161 - 210
Target Start/End: Original strand, 30940768 - 30940817
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30940768 |
atccccgtgagcttagctcagttggtagtgatattgcatattatatgcag |
30940817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 32677008 - 32676963
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32677008 |
tgagcttagctcagttggtagggatattgcatattatatgcaggag |
32676963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 34267621 - 34267572
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34267621 |
cccgtgagcttagctcagttggtaggaatattgcatattatatgcaggag |
34267572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 157 - 213
Target Start/End: Original strand, 4960777 - 4960833
Alignment:
| Q |
157 |
tgacatccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||| || ||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4960777 |
tgacatctccttgagcttagctcagttagtagggatattgcatattatatgcaggag |
4960833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 15106764 - 15106712
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||| |||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15106764 |
atcccggtgagcttaactcagttggtagggatattgcatattatatgcaggag |
15106712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 26801802 - 26801750
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26801802 |
atccccgtgagtatagctcagttggtaggaatattgcatattatatgcaggag |
26801750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 36469778 - 36469726
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
36469778 |
atccccgtgagcttagctcagttggtagggatattacatattacatgcaggag |
36469726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 48288470 - 48288422
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48288470 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcaggag |
48288422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 21066882 - 21066929
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21066882 |
catccccgtgagtttagctcagttggtagggatattgcatattatatg |
21066929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 36720109 - 36720156
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36720109 |
cgtgagcttagctcagttggtagggatattgcatattatatacaggag |
36720156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 41465834 - 41465881
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41465834 |
cccgtaagcttagctcagttggtagggatattgcatattatatgcagg |
41465881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 9712267 - 9712221
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9712267 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
9712221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 24188471 - 24188517
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24188471 |
ccgtgagcatagctcagttggtagggatactgcatattatatgcagg |
24188517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 207
Target Start/End: Original strand, 24508823 - 24508869
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24508823 |
atcccagtgagcgtagttcagttggtagggatattgcatattatatg |
24508869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 32984284 - 32984238
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32984284 |
gtgagcttagctcagttggtagggatattgcatattatatacaggag |
32984238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 35815835 - 35815885
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
35815835 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
35815885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 36389739 - 36389689
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
36389739 |
atccccgtgagcttagctcagttggtagggatattgtattttatatgcagg |
36389689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 48119467 - 48119517
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48119467 |
atccctgtgagcttagctcagttggtagggatattgcattttatatgcagg |
48119517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 161 - 210
Target Start/End: Complemental strand, 9929977 - 9929928
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9929977 |
atccccgttagcttagctcagttggtagggatattgaatattatatgcag |
9929928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 161 - 210
Target Start/End: Original strand, 29625918 - 29625967
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||| ||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
29625918 |
atccacgtgagcttaactcagttggtagggatattgcatattatatgcag |
29625967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 24880521 - 24880473
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24880521 |
ccgtaagcttagctcagttggtagggatattgaatattatatgcaggag |
24880473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 209
Target Start/End: Original strand, 36622171 - 36622219
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||| | ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36622171 |
atccccgtgaacttagctcaattggtagggatattgcatattatatgca |
36622219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 209
Target Start/End: Original strand, 39098133 - 39098181
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||| |||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39098133 |
atccctgtgagcttagttcagttggtagggatattgcatattatatgca |
39098181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 176 - 211
Target Start/End: Complemental strand, 1563797 - 1563762
Alignment:
| Q |
176 |
gctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
1563797 |
gctcagttggtagggatattgcatattatatgcagg |
1563762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 262 - 317
Target Start/End: Complemental strand, 2624445 - 2624390
Alignment:
| Q |
262 |
aaaaataacctatattacagaaggtaaaacactattaaccctttctcttatagatg |
317 |
Q |
| |
|
|||||| |||||||||||||| ||||||| |||||||||||||||| |||| |||| |
|
|
| T |
2624445 |
aaaaatgacctatattacagagggtaaaagactattaaccctttcttttattgatg |
2624390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 209
Target Start/End: Original strand, 5833037 - 5833084
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||| |||||||| |
|
|
| T |
5833037 |
tccccgtgagcttagctcagttggtagggataatgcataatatatgca |
5833084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 164 - 207
Target Start/End: Complemental strand, 18223787 - 18223744
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
18223787 |
cccgtgagcttaactcagttggtagggatattgcatattatatg |
18223744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 164 - 207
Target Start/End: Complemental strand, 24062081 - 24062038
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
24062081 |
cccgtgagcttagctcagttagtagggatattgcatattatatg |
24062038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 209
Target Start/End: Complemental strand, 26816730 - 26816683
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||| |||||||| |
|
|
| T |
26816730 |
tccccgtgagcttagctcagttggtagggataatgcataatatatgca |
26816683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 168 - 211
Target Start/End: Original strand, 28805304 - 28805347
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28805304 |
tgagcttagctcagttggtagggatattgcatatcatatgcagg |
28805347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 213
Target Start/End: Complemental strand, 31769568 - 31769533
Alignment:
| Q |
178 |
tcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
31769568 |
tcagttggtagggatattgcatattatatgcaggag |
31769533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 147 - 213
Target Start/End: Original strand, 32619332 - 32619399
Alignment:
| Q |
147 |
atattgtttttga-catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||| | ||||||||||||| || |||||||| || ||||||||||||||||||| ||||| |
|
|
| T |
32619332 |
atattgtttttaaacatccccgtgagcttaactcagttgttaaggatattgcatattatatgtaggag |
32619399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 35683197 - 35683150
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
35683197 |
cccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
35683150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 174 - 213
Target Start/End: Original strand, 48719809 - 48719848
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48719809 |
tagctcagttggtaggaatattgcatattatatgcaggag |
48719848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 5073264 - 5073314
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| || |||||||||||| ||||||| |||||||||||||| |
|
|
| T |
5073264 |
atccccgtgagcttaactcagttggtagagatattgtatattatatgcagg |
5073314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 7525441 - 7525491
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
7525441 |
atccccgtgagtttagttcagttggtaaggatattgcatattatatgcagg |
7525491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 9233835 - 9233785
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||| || ||||||||||| |
|
|
| T |
9233835 |
atccccgtgagcttaactcagttggtagggatattgaattttatatgcagg |
9233785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 10226672 - 10226722
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| ||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
10226672 |
atccccgtgagtttagttcagttggtagggatgttgcatattatatgcagg |
10226722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 12264055 - 12264101
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12264055 |
ccgtgaacttagctcagttggtagggatattgcattttatatgcagg |
12264101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 12615748 - 12615798
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| ||||| || |||||||| |||||||||||||||||||||||||| |
|
|
| T |
12615748 |
atccccttgagcttaactcagttgatagggatattgcatattatatgcagg |
12615798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 13720767 - 13720817
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13720767 |
atccccgtgaagttagctcagttggttgggatattgcatattatatgcagg |
13720817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 15694547 - 15694597
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||| |||||||||||||| |
|
|
| T |
15694547 |
atccccgtgagcttaattcagttggtagggatattgtatattatatgcagg |
15694597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 15701527 - 15701577
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||| |||||||||||||| |
|
|
| T |
15701527 |
atccccgtgagcttaattcagttggtagggatattgtatattatatgcagg |
15701577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 263 - 305
Target Start/End: Complemental strand, 17167540 - 17167498
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaacccttt |
305 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17167540 |
aaaatgacctatattacagatggtaaaacactattaacccttt |
17167498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 21762965 - 21762915
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| | || ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21762965 |
atccccgtgaacttatctcagttggtaaggatattgcatattatatgcagg |
21762915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 23755087 - 23755037
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||||||||||||| |||||||| |
|
|
| T |
23755087 |
atccccgtgagcttagctcaatcggtagggatattgcatattttatgcagg |
23755037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 27704372 - 27704322
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| | || ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27704372 |
atccccgtgaacttaactcagttggtaggaatattgcatattatatgcagg |
27704322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 32074468 - 32074418
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
32074468 |
atccccgtgagcttagctcagttggtagggatatcacattttatatgcagg |
32074418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 38824694 - 38824648
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
38824694 |
ccgtgagcttagctcagttgatagggatattgcgtattatatgcagg |
38824648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 42182267 - 42182221
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| || |||||||||||||| |||||||||||||||||||| |
|
|
| T |
42182267 |
ccgtgagcttaactcagttggtaggggtattgcatattatatgcagg |
42182221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 10683 - 10646
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10683 |
tagcttagttggtagggatattgcatattatatgcagg |
10646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 15074962 - 15074925
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15074962 |
tagctcagttgatagggatattgcatattatatgcagg |
15074925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 160 - 213
Target Start/End: Complemental strand, 19331571 - 19331518
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||| ||| ||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
19331571 |
catccccgtgagcttagtgcagttggtacggatattgcattttatatgcaggag |
19331518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 262 - 303
Target Start/End: Complemental strand, 24757401 - 24757360
Alignment:
| Q |
262 |
aaaaataacctatattacagaaggtaaaacactattaaccct |
303 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24757401 |
aaaaatgacctatattacagaaggtaaaacaccattaaccct |
24757360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 174 - 211
Target Start/End: Original strand, 27633941 - 27633978
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27633941 |
tagcttagttggtagggatattgcatattatatgcagg |
27633978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 177 - 213
Target Start/End: Original strand, 8174129 - 8174165
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8174129 |
ctcagttggtagggatattgcattttatatgcaggag |
8174165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 13730164 - 13730120
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
13730164 |
gtgagcttagcttagttggtagagatattgcatattatatgcagg |
13730120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 207
Target Start/End: Complemental strand, 24732618 - 24732578
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
24732618 |
gtgagcttagctcagttgttagggatattgcatattatatg |
24732578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 161 - 209
Target Start/End: Complemental strand, 27679083 - 27679035
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||| ||||||| || ||||||||||| ||||||||||||||||||||| |
|
|
| T |
27679083 |
atcctcgtgagcttaactcagttggtatggatattgcatattatatgca |
27679035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 3532574 - 3532625
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| ||||| | ||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
3532574 |
catcctcgtgatcttagttcagttggtagggatattgcataatatatgcagg |
3532625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 177 - 212
Target Start/End: Complemental strand, 7401444 - 7401409
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcagga |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7401444 |
ctcagttggtagggatattgtatattatatgcagga |
7401409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 269 - 304
Target Start/End: Complemental strand, 10067789 - 10067754
Alignment:
| Q |
269 |
acctatattacagaaggtaaaacactattaaccctt |
304 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10067789 |
acctatattacagatggtaaaacactattaaccctt |
10067754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 172 - 211
Target Start/End: Original strand, 10690855 - 10690894
Alignment:
| Q |
172 |
cgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
10690855 |
cgtagctcagctgatagggatattgcatattatatgcagg |
10690894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 168 - 211
Target Start/End: Original strand, 15655708 - 15655751
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| ||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
15655708 |
tgagcttagctcaattggtagggatattgcattttatatgcagg |
15655751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 174 - 209
Target Start/End: Complemental strand, 15716745 - 15716710
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15716745 |
tagctcagttggtagggatattgcgtattatatgca |
15716710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 31191670 - 31191623
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| || |||||||||| ||||||||||||||||||||||| |
|
|
| T |
31191670 |
cccgtgagcttaattcagttggtaaggatattgcatattatatgcagg |
31191623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 32856987 - 32856940
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| | ||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
32856987 |
cccgtgaacttagcttaattggtagggatattgcatattatatgcagg |
32856940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 165 - 212
Target Start/End: Original strand, 41699640 - 41699687
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagga |
212 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||| |||| |
|
|
| T |
41699640 |
ccgtgagcttagctcagttagtagggatattgcatatcatatgtagga |
41699687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 211
Target Start/End: Complemental strand, 1398960 - 1398926
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
1398960 |
ctcagttggttgggatattgcatattatatgcagg |
1398926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 3529777 - 3529827
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||| |||||| |||| |
|
|
| T |
3529777 |
atccccgtgagtttaactcagttggtagggatattgcattttatatacagg |
3529827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 207
Target Start/End: Original strand, 9497963 - 9498009
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||| ||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
9497963 |
atccccgcgagtttagctcaattggtagggatattgcatattatatg |
9498009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 16200556 - 16200606
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| |||||| ||||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
16200556 |
atcccggtgagcttagcttaattggtaggaatattgcatattatatgcagg |
16200606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 207
Target Start/End: Complemental strand, 19922169 - 19922123
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||||||||| ||||||| |
|
|
| T |
19922169 |
atccccgtgagcttagcttagttgatagggatattgcattttatatg |
19922123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 263 - 305
Target Start/End: Original strand, 21444201 - 21444243
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaacccttt |
305 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21444201 |
aaaatgacctatattacagggggtaaaacactattaacccttt |
21444243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 28444155 - 28444105
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| || |||||||||||| ||||| |||| ||||||||||| |
|
|
| T |
28444155 |
atccccgtgagcttaactcagttggtagagatatcgcattttatatgcagg |
28444105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 167 - 205
Target Start/End: Original strand, 28735731 - 28735769
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattata |
205 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
28735731 |
gtgagcttaactcagttggtagggatattgcatattata |
28735769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 168 - 210
Target Start/End: Complemental strand, 35612633 - 35612591
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||| ||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
35612633 |
tgagcttagctcaattggtagggagattgcatattatatgcag |
35612591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 270 - 304
Target Start/End: Original strand, 42509063 - 42509097
Alignment:
| Q |
270 |
cctatattacagaaggtaaaacactattaaccctt |
304 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42509063 |
cctatattacagagggtaaaacactattaaccctt |
42509097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 212
Target Start/End: Complemental strand, 45640164 - 45640114
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagga |
212 |
Q |
| |
|
||||||||||| || || |||| |||||||||||| ||||||||||||||| |
|
|
| T |
45640164 |
tccccgtgagcttaacttagttagtagggatattgtatattatatgcagga |
45640114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 48413993 - 48413947
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||| ||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
48413993 |
gtgagcttagctcaattggcagagatattgcatattatatgcaggag |
48413947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 207
Target Start/End: Original strand, 3392465 - 3392510
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||||||| || |||||||| || ||||||||||||||||||| |
|
|
| T |
3392465 |
tccccgtgagcttaactcagttgatatggatattgcatattatatg |
3392510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 7876001 - 7876046
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||| | |||||||| |
|
|
| T |
7876001 |
cgtgagcttagctcagttggtagggacattgcataatttatgcagg |
7876046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 160 - 209
Target Start/End: Original strand, 11692384 - 11692433
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| |||| |||||||| |
|
|
| T |
11692384 |
catccccgtgagtttagctcagatggtagggatattacataatatatgca |
11692433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 211
Target Start/End: Original strand, 11745197 - 11745234
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
11745197 |
tagctcagttggtagagatattgcattttatatgcagg |
11745234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 161 - 206
Target Start/End: Original strand, 12364746 - 12364791
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||| ||||||||| |
|
|
| T |
12364746 |
atccccgtgagcttaactcacttggtagggatattgtatattatat |
12364791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 210
Target Start/End: Original strand, 19828127 - 19828172
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||||| | ||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
19828127 |
ccgtgaacttagctcagttggtagggatatcgcattttatatgcag |
19828172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 263 - 304
Target Start/End: Original strand, 20164441 - 20164482
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaaccctt |
304 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20164441 |
aaaatgacctatattacagggggtaaaacactattaaccctt |
20164482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 211
Target Start/End: Complemental strand, 23274886 - 23274837
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| ||||| |||||||||||| |||||||| | |||||||| |
|
|
| T |
23274886 |
tccccgtgagcttagctaagttggtagggacattgcataatttatgcagg |
23274837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 211
Target Start/End: Complemental strand, 34051930 - 34051897
Alignment:
| Q |
178 |
tcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
34051930 |
tcagttggtagtgatattgcatattatatgcagg |
34051897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 263 - 304
Target Start/End: Original strand, 34258441 - 34258482
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaaccctt |
304 |
Q |
| |
|
||||||||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
34258441 |
aaaataacccatattatagagggtaaaacactattaaccctt |
34258482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 207
Target Start/End: Complemental strand, 40518961 - 40518916
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||||| | |||||||||||||||||| |||||||| |||||| |
|
|
| T |
40518961 |
tccccgtgaacttagctcagttggtagggacattgcataatatatg |
40518916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 41853995 - 41854044
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| |||||||||||| ||||| |||||||| | |||||||| |
|
|
| T |
41853995 |
tccccgtgagcttagctcagttggcagggacattgcataatttatgcagg |
41854044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 42352648 - 42352697
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| | |||||||||||||||| ||||| || |||||||||| |
|
|
| T |
42352648 |
tccccgtgagctttgctcagttggtagggacattgcctaatatatgcagg |
42352697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 44593552 - 44593503
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| || ||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
44593552 |
cccgtgagcttaactcagttaatagagatattgcatattatatgcaggag |
44593503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 47255152 - 47255103
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| || ||||||||| || ||||||||||||||| |||||||| |
|
|
| T |
47255152 |
cccgtgagcttaactcagttggcagagatattgcatattatctgcaggag |
47255103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 162 - 194
Target Start/End: Original strand, 1649147 - 1649179
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatat |
194 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
1649147 |
tccccgtgagcatagctcagttggtagggatat |
1649179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 209
Target Start/End: Original strand, 5804852 - 5804900
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||| || ||| ||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
5804852 |
atccctgtaagcttagcttagttggtagggatattgcattttatatgca |
5804900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 263 - 299
Target Start/End: Original strand, 10975860 - 10975896
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaa |
299 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10975860 |
aaaataacctatattacagggggtaaaacactattaa |
10975896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 174 - 210
Target Start/End: Complemental strand, 16961684 - 16961648
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||| |
|
|
| T |
16961684 |
tagctcagttggtagggatattgtattttatatgcag |
16961648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 25318609 - 25318557
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||| ||| ||| |||||||||||||||||| ||||||| ||||| |
|
|
| T |
25318609 |
atccccgtgagtctagttcaattggtagggatattgcattttatatgtaggag |
25318557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 174 - 210
Target Start/End: Complemental strand, 28424391 - 28424355
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
28424391 |
tagctcagtttgtagggaaattgcatattatatgcag |
28424355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 174 - 206
Target Start/End: Complemental strand, 30004609 - 30004577
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
30004609 |
tagctcagttggtagggatattacatattatat |
30004577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 31475939 - 31475891
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgca-tattatatgcagg |
211 |
Q |
| |
|
||||||||| |||||||||||| ||||| |||||| ||||||||||||| |
|
|
| T |
31475939 |
cccgtgagcatagctcagttggcagggacattgcattattatatgcagg |
31475891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 34010689 - 34010649
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaaccct |
303 |
Q |
| |
|
||||| ||||||||||||| | ||||||||||||||||||| |
|
|
| T |
34010689 |
aaaatgacctatattacaggaagtaaaacactattaaccct |
34010649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 167 - 199
Target Start/End: Original strand, 38151347 - 38151379
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcat |
199 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
38151347 |
gtgagcttagctcagttggtagggatattgcat |
38151379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 40938155 - 40938115
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaaccct |
303 |
Q |
| |
|
||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
40938155 |
aaaataacctatatttcaaagggtaaaacactattaaccct |
40938115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 164 - 208
Target Start/End: Complemental strand, 42798386 - 42798342
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgc |
208 |
Q |
| |
|
||||||||| || | ||||| |||||||||||||||||||||||| |
|
|
| T |
42798386 |
cccgtgagcttaacccagtttgtagggatattgcatattatatgc |
42798342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 43633155 - 43633111
Alignment:
| Q |
169 |
gagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||| ||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
43633155 |
gagcttagctcagttgatagggatattatatattatatgcaggag |
43633111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 44377112 - 44377068
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| || |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
44377112 |
gtgagcttaactcagttggtagagatattacatattatatgcagg |
44377068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 44385979 - 44385935
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| || |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
44385979 |
gtgagcttaactcagttggtagagatattacatattatatgcagg |
44385935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 269 - 304
Target Start/End: Original strand, 47161780 - 47161816
Alignment:
| Q |
269 |
acctatattacagaagg-taaaacactattaaccctt |
304 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47161780 |
acctatattacagaaggctaaaacactattaaccctt |
47161816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 49053998 - 49054042
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| ||| |||||||||| | ||||||||||||||||||||| |
|
|
| T |
49053998 |
gtgagcttagttcagttggtacgaatattgcatattatatgcagg |
49054042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 53; Significance: 2e-21; HSPs: 114)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 161 - 217
Target Start/End: Complemental strand, 3794246 - 3794190
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgg |
217 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3794246 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcgg |
3794190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 161 - 217
Target Start/End: Complemental strand, 9246455 - 9246399
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgg |
217 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9246455 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcgg |
9246399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 160 - 213
Target Start/End: Original strand, 7207840 - 7207893
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7207840 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
7207893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 10934596 - 10934648
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10934596 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
10934648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 17441912 - 17441860
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17441912 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
17441860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 19953901 - 19953849
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19953901 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
19953849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 33573814 - 33573866
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33573814 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
33573866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 4408355 - 4408405
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4408355 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
4408405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 7545326 - 7545376
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7545326 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
7545376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 7865428 - 7865378
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7865428 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
7865378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 9372274 - 9372224
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9372274 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
9372224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 9435623 - 9435673
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9435623 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
9435673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 15091445 - 15091495
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15091445 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
15091495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 158 - 211
Target Start/End: Complemental strand, 27094883 - 27094830
Alignment:
| Q |
158 |
gacatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27094883 |
gacatccccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
27094830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 160 - 208
Target Start/End: Original strand, 607183 - 607231
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgc |
208 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
607183 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgc |
607231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 159 - 211
Target Start/End: Original strand, 4661091 - 4661143
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4661091 |
acatccccgtgagcttagcttagttggtagggatattgcatattatatgcagg |
4661143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 9704414 - 9704466
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9704414 |
atccccgtgaacttagctcagttggtagggatattgcatattatatgcaggag |
9704466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 31802050 - 31802102
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31802050 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggag |
31802102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 8439675 - 8439722
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8439675 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
8439722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 1968993 - 1969043
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1968993 |
atccccgtgagcttagctcagttggtagggatattacatattatatgcagg |
1969043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 3294765 - 3294811
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3294765 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
3294811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 6210051 - 6210101
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6210051 |
atccccgtgaacttagctcagttggtagggatattgcatattatatgcagg |
6210101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 8857087 - 8857137
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8857087 |
atccccgtgagcttagctcagttggtagggatattacatattatatgcagg |
8857137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 28030861 - 28030911
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28030861 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
28030911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 30885643 - 30885593
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30885643 |
atccccgtgagcttagctcagttggtagggatattgcatattatatacagg |
30885593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 160 - 213
Target Start/End: Complemental strand, 28148807 - 28148754
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||| ||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28148807 |
catccccttgaacttagctcagttggtagggatattgcatattatatgcaggag |
28148754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 32611620 - 32611575
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32611620 |
tgagcttagctcagttggtagggatattgcatattatatgcaggag |
32611575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 159 - 211
Target Start/End: Complemental strand, 978209 - 978157
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
978209 |
acatccccgtgagtttagctcagttagtagggatattgcatattatatgcagg |
978157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 163 - 211
Target Start/End: Original strand, 2251837 - 2251885
Alignment:
| Q |
163 |
ccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2251837 |
ccccgtgagcttagctcagttggtagggatattgcatactatatgcagg |
2251885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 209
Target Start/End: Original strand, 13732809 - 13732857
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
13732809 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgca |
13732857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 17454818 - 17454766
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17454818 |
atccccgtgagcttatctcagttggtagagatattgcatattatatgcaggag |
17454766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 28237325 - 28237273
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||| ||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28237325 |
atcctcgtgagcttaactcagttggtagggatattgcatattatatgcaggag |
28237273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 743565 - 743612
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
743565 |
cgtgagcttagctcagttggtagggatattgcatattagatgcaggag |
743612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 4869768 - 4869721
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4869768 |
cccgtgagcttagctcagttggtagggatactgcatattatatgcagg |
4869721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 32166369 - 32166416
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32166369 |
cccgtgagcttagctcaattggtagggatattgcatattatatgcagg |
32166416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 211
Target Start/End: Complemental strand, 32813724 - 32813673
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
32813724 |
catccccgtgagcttagttcagttggtacggatattgcatattatatgcagg |
32813673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 361166 - 361212
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
361166 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggag |
361212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 7177292 - 7177342
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
7177292 |
atccccgtgagcttagctcagttggtagggatattgtattttatatgcagg |
7177342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 10483609 - 10483559
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10483609 |
atccccgtgatcttagctcagttggtagggatattgcattttatatgcagg |
10483559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 10517196 - 10517246
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
10517196 |
atccccgtgagcttagctcagttggtatggatattgcattttatatgcagg |
10517246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 19374913 - 19374863
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
19374913 |
atccccgtgagcttagctcagttagtaggaatattgcatattatatgcagg |
19374863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 207
Target Start/End: Complemental strand, 19892349 - 19892303
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
19892349 |
atccccgtgagcttagttcagttggtagggatattgcatattatatg |
19892303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 22574867 - 22574917
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
22574867 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
22574917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 207
Target Start/End: Original strand, 29284263 - 29284309
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29284263 |
atccccgtgagtttagctcagttggtagggatattgcatattatatg |
29284309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 164 - 210
Target Start/End: Complemental strand, 34432867 - 34432821
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34432867 |
cccgtgagcttagttcagttggtagggatattgcatattatatgcag |
34432821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 3795834 - 3795797
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3795834 |
tagctcagttggtagggatattgcatattatatgcagg |
3795797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 10501199 - 10501162
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10501199 |
tagctcagttggtagggatattgcatattatatgcagg |
10501162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 32050035 - 32049986
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| || ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32050035 |
cccgtgagcttaactcagctggtagggatattgcatattatatgcaggag |
32049986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 209
Target Start/End: Original strand, 3640511 - 3640559
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3640511 |
atcctcgtgagcttagctcagttggtagggatattgcatagtatatgca |
3640559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 5052146 - 5052094
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||| |||| ||||||||||||| |
|
|
| T |
5052146 |
atccccgtgagcttagctcaattggtagggatatcgcattttatatgcaggag |
5052094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 159 - 211
Target Start/End: Original strand, 10628609 - 10628661
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| ||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10628609 |
acatctccgtgagtttagctcggttggtagggatattgcatattatatgcagg |
10628661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 31935102 - 31935146
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31935102 |
gtgagcttagctcagttggtagggatattgcattttatatgcagg |
31935146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 166 - 209
Target Start/End: Original strand, 7414331 - 7414374
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
7414331 |
cgtgagcttggctcagttggtagggatattgcatattatatgca |
7414374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 168 - 211
Target Start/End: Complemental strand, 15964009 - 15963966
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15964009 |
tgagcttagctcagttggtagggatattgcatattttatgcagg |
15963966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 174 - 209
Target Start/End: Complemental strand, 16966454 - 16966419
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
16966454 |
tagctcagttggtagggatattgcatattatatgca |
16966419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 211
Target Start/End: Complemental strand, 33697187 - 33697136
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| || |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
33697187 |
catccccgtgagcttaactcagttgatagggatattgcattttatatgcagg |
33697136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 216203 - 216253
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| |||||| ||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
216203 |
atcccagtgagcttagctcaattggtagggatattgcatgttatatgcagg |
216253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 492903 - 492949
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| |||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
492903 |
ccgtgagcttagctcagttggcaaggatattgcatattatatgcagg |
492949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 2816887 - 2816937
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| ||||| ||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
2816887 |
atccccatgagcttagctcaattggtagggatattgcatgttatatgcagg |
2816937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 164 - 206
Target Start/End: Original strand, 3196619 - 3196661
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
3196619 |
cccgtgagcttagctcagttggtagggatattacatattatat |
3196661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 6419155 - 6419105
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| || |||||||||||| |||||||||||||||||||||| |
|
|
| T |
6419155 |
atccccgtgagtttaactcagttggtagagatattgcatattatatgcagg |
6419105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 7581041 - 7581091
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||| || ||||||||||||||||| ||||||||||| |
|
|
| T |
7581041 |
atccccgtgagcttagcttagctggtagggatattgcattttatatgcagg |
7581091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 8297624 - 8297674
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| |||||| ||||||||||| |
|
|
| T |
8297624 |
atccccgtgagcttagctcaattggtagggatgttgcatgttatatgcagg |
8297674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 12284122 - 12284168
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| || |||||||||||||||||||| |||||||||||||| |
|
|
| T |
12284122 |
ccgtgagcttaactcagttggtagggatattgaatattatatgcagg |
12284168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 160 - 218
Target Start/End: Complemental strand, 14579360 - 14579302
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgga |
218 |
Q |
| |
|
|||||||||||| ||||| | ||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
14579360 |
catccccgtgagtttagcttatttggtagggatattgcaaattatatgcaggagtcgga |
14579302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 207
Target Start/End: Original strand, 21248529 - 21248575
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
21248529 |
atccccgtaagcttagctcagttggtagggatattgcattttatatg |
21248575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 207
Target Start/End: Original strand, 22997337 - 22997379
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
22997337 |
ccgtgagcttagctcagttggtagggatattgaatattatatg |
22997379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 207
Target Start/End: Complemental strand, 23791064 - 23791022
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
23791064 |
ccgtgagcttagctcagttggtagggatattgaatattatatg |
23791022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 164 - 210
Target Start/End: Original strand, 28222863 - 28222909
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||| | || |||||||||||||||||||||||||||||||||| |
|
|
| T |
28222863 |
cccgtgaacttaactcagttggtagggatattgcatattatatgcag |
28222909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 29733625 - 29733675
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| | |||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
29733625 |
atccccgtgaacttagctcagttggtacggatattacatattatatgcagg |
29733675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 168 - 218
Target Start/End: Complemental strand, 30700257 - 30700207
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgga |
218 |
Q |
| |
|
||||| || ||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
30700257 |
tgagcttaactcagttggtacggatattgcatattatatgcaggagtcgga |
30700207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 207
Target Start/End: Original strand, 30704957 - 30705003
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
30704957 |
atccccgtgagcttagttcagttggtagggatattgcatgttatatg |
30705003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 31104879 - 31104929
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||| ||||||| |||||||||| ||||||||||||||| |
|
|
| T |
31104879 |
atccccgtgagcttagttcagttgatagggatattacatattatatgcagg |
31104929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 4089987 - 4089950
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4089987 |
tagctcagtcggtagggatattgcatattatatgcagg |
4089950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 7418280 - 7418325
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| || |||| |||||||||||||||||||||||||||||| |
|
|
| T |
7418280 |
cgtgagcttaactcatttggtagggatattgcatattatatgcagg |
7418325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 11301371 - 11301416
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||| ||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
11301371 |
tgagcatagctcagttgataggaatattgcatattatatgcaggag |
11301416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 162 - 211
Target Start/End: Complemental strand, 20568357 - 20568308
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| |||||||||||||| ||| |||||||| |||||||||| |
|
|
| T |
20568357 |
tccccgtgagcttagctcagttggtaaggacattgcataatatatgcagg |
20568308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 27218884 - 27218933
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||| | ||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
27218884 |
cccgtgaccttagctcagttgatagggatattgcatattatatgtaggag |
27218933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 178 - 211
Target Start/End: Complemental strand, 32412369 - 32412336
Alignment:
| Q |
178 |
tcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32412369 |
tcagttggtagggatattgcatattatatgcagg |
32412336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 177 - 213
Target Start/End: Original strand, 7072091 - 7072127
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7072091 |
ctcagttggtagggatattacatattatatgcaggag |
7072127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 174 - 210
Target Start/End: Complemental strand, 13158769 - 13158733
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13158769 |
tagctaagttggtagggatattgcatattatatgcag |
13158733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 174 - 210
Target Start/End: Complemental strand, 13163625 - 13163589
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13163625 |
tagctaagttggtagggatattgcatattatatgcag |
13163589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 180 - 211
Target Start/End: Complemental strand, 894686 - 894655
Alignment:
| Q |
180 |
agttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
894686 |
agttggtagggatattgcatattatatgcagg |
894655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 3299037 - 3298990
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| ||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
3299037 |
cccgtgagcttagatcaattggtagggatattgcatataatatgcagg |
3298990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 180 - 211
Target Start/End: Original strand, 5944442 - 5944473
Alignment:
| Q |
180 |
agttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5944442 |
agttggtagggatattgcatattatatgcagg |
5944473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 168 - 211
Target Start/End: Original strand, 7153792 - 7153835
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| || ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7153792 |
tgagcttaactcagttggtagggatattgcatgttatatgcagg |
7153835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 263 - 310
Target Start/End: Complemental strand, 10545870 - 10545823
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaaccctttctctt |
310 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
10545870 |
aaaatgacctatattacagggggtaaaacactattaaccctttttctt |
10545823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 206
Target Start/End: Complemental strand, 19618799 - 19618756
Alignment:
| Q |
163 |
ccccgtgagcgtagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
19618799 |
ccccgtgagtttagctcaattggtagggatattgcatattatat |
19618756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 207
Target Start/End: Original strand, 21203038 - 21203081
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
21203038 |
cccgtgagtttagctcagttggtagggatattgcatatcatatg |
21203081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 218
Target Start/End: Complemental strand, 31789618 - 31789583
Alignment:
| Q |
183 |
tggtagggatattgcatattatatgcaggaggcgga |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31789618 |
tggtagggatattgcatattatatgcaggagccgga |
31789583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 164 - 210
Target Start/End: Complemental strand, 1100309 - 1100263
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||| | ||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
1100309 |
cccgtgaacttagctcagttggtagggatatagcattttatatgcag |
1100263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 1435806 - 1435856
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||| ||||||| || |||||| |||||||||||| ||||||||||||||| |
|
|
| T |
1435806 |
atcctcgtgagcttaactcagtaggtagggatattacatattatatgcagg |
1435856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 207
Target Start/End: Complemental strand, 2500583 - 2500541
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||| || ||||| |||||||||||||||||||||||||||| |
|
|
| T |
2500583 |
ccgtgtgcttagcttagttggtagggatattgcatattatatg |
2500541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 7328716 - 7328670
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||| |||||| |||| |
|
|
| T |
7328716 |
ccgtgagcttaactcagttggtagggatattgcattttatatccagg |
7328670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 160 - 218
Target Start/End: Original strand, 20584069 - 20584127
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgga |
218 |
Q |
| |
|
|||||| |||||| || |||||||| ||| ||||||||||||||||| |||||| |||| |
|
|
| T |
20584069 |
catccctgtgagcttaactcagttgatagcgatattgcatattatatacaggagccgga |
20584127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 23610388 - 23610342
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||| | |||||||| |
|
|
| T |
23610388 |
ccgtgagcttagctcagttggtagggacattgcataatttatgcagg |
23610342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 24758736 - 24758786
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||| |||| ||||||||||| |
|
|
| T |
24758736 |
atccccgtgagcttaactcaattggtagggatatcgcattttatatgcagg |
24758786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 199
Target Start/End: Original strand, 31705896 - 31705934
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcat |
199 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
31705896 |
atccccgtgagcttagctcagttggtatggatattgcat |
31705934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 2688648 - 2688607
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
|||| ||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
2688648 |
ccgttagcttagctcagttggtaaggatattgcatattatat |
2688607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 211
Target Start/End: Original strand, 5694928 - 5694961
Alignment:
| Q |
178 |
tcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
5694928 |
tcagttggtagggatattgtatattatatgcagg |
5694961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 211
Target Start/End: Complemental strand, 6658643 - 6658594
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| ||||| |||| ||||||| |||||||| |||||||||| |
|
|
| T |
6658643 |
tccccgtgagcttagcttagttagtagggaaattgcataatatatgcagg |
6658594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 263 - 300
Target Start/End: Original strand, 10546197 - 10546234
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaac |
300 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
10546197 |
aaaatgacctatattacagagggtaaaacactattaac |
10546234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 264 - 305
Target Start/End: Complemental strand, 13552646 - 13552605
Alignment:
| Q |
264 |
aaataacctatattacagaaggtaaaacactattaacccttt |
305 |
Q |
| |
|
|||| |||||||||||| | |||||||||||||||||||||| |
|
|
| T |
13552646 |
aaatgacctatattacaaagggtaaaacactattaacccttt |
13552605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 30938390 - 30938435
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| || ||||||||||||||| |||||||| |||||||||| |
|
|
| T |
30938390 |
cgtgagcttaactcagttggtagggacattgcataatatatgcagg |
30938435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 207
Target Start/End: Original strand, 32837344 - 32837385
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||| ||||||||||| |||||||||| ||||||||||| |
|
|
| T |
32837344 |
cgtgagcttagctcagttgctagggatattacatattatatg |
32837385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 34268280 - 34268329
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| |||||| ||||||||||| |||||||| | |||||||| |
|
|
| T |
34268280 |
tccccgtgagcttagctccgttggtagggacattgcataatttatgcagg |
34268329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 264 - 303
Target Start/End: Complemental strand, 1227715 - 1227675
Alignment:
| Q |
264 |
aaataacctatattacagaagg-taaaacactattaaccct |
303 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
1227715 |
aaataacctatattacaggagggtaaaacactattaaccct |
1227675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 205
Target Start/End: Complemental strand, 7470802 - 7470758
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattata |
205 |
Q |
| |
|
|||| ||| ||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
7470802 |
atcctcgtaagcttagctcagttggtagggataatgcatattata |
7470758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 177 - 213
Target Start/End: Complemental strand, 9888582 - 9888546
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
9888582 |
ctcagttggtagggatattgtatattctatgcaggag |
9888546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 264 - 303
Target Start/End: Original strand, 11107869 - 11107909
Alignment:
| Q |
264 |
aaataacctatattacag-aaggtaaaacactattaaccct |
303 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11107869 |
aaatgacctatattacaggaaggtaaaacactattaaccct |
11107909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 177 - 209
Target Start/End: Original strand, 15285556 - 15285588
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
15285556 |
ctcagttggtagggatattacatattatatgca |
15285588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 163 - 207
Target Start/End: Original strand, 26347403 - 26347447
Alignment:
| Q |
163 |
ccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||| | ||||||||||||||| ||||||| |||||||||| |
|
|
| T |
26347403 |
ccccgtgaacttagctcagttggtagagatattgtatattatatg |
26347447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 197
Target Start/End: Complemental strand, 30391293 - 30391257
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgc |
197 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
30391293 |
atccccgtgagcttagctcagttgttagggatattgc |
30391257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 174 - 202
Target Start/End: Complemental strand, 31803656 - 31803628
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatatt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31803656 |
tagctcagttggtagggatattgcatatt |
31803628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 53; Significance: 2e-21; HSPs: 142)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 5966826 - 5966878
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5966826 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
5966878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 161 - 217
Target Start/End: Original strand, 27765254 - 27765310
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgg |
217 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27765254 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcgg |
27765310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 159 - 213
Target Start/End: Complemental strand, 6518851 - 6518797
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6518851 |
acatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
6518797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 160 - 213
Target Start/End: Original strand, 12463752 - 12463805
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12463752 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
12463805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 160 - 213
Target Start/End: Original strand, 32505684 - 32505737
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32505684 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
32505737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 160 - 213
Target Start/End: Complemental strand, 41179877 - 41179824
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41179877 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
41179824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 161 - 218
Target Start/End: Original strand, 42320314 - 42320371
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgga |
218 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42320314 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcgga |
42320371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 1743124 - 1743176
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1743124 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
1743176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 4417758 - 4417706
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4417758 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
4417706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 9835030 - 9835082
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9835030 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
9835082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 11897245 - 11897297
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11897245 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
11897297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 21918049 - 21918101
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21918049 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
21918101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 17545245 - 17545195
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17545245 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
17545195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 161 - 210
Target Start/End: Original strand, 16603395 - 16603444
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16603395 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcag |
16603444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 35515512 - 35515561
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35515512 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
35515561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 160 - 213
Target Start/End: Complemental strand, 36888469 - 36888416
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36888469 |
catccccgtgagcttagttcagttggtagggatattgcatattatatgcaggag |
36888416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 2328589 - 2328641
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2328589 |
atccccgtgagcttagcttagttggtagggatattgcatattatatgcaggag |
2328641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 217
Target Start/End: Original strand, 2848210 - 2848266
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgg |
217 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
2848210 |
atccccgtgagcttagctcagttggtagggatattgtatattatatgcatgaggcgg |
2848266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 8968750 - 8968798
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8968750 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
8968798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 12767961 - 12768013
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12767961 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgcaggag |
12768013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 21749450 - 21749398
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21749450 |
atccccgtgagcttagctcagttggtagggatactgcatattatatgcaggag |
21749398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 25648158 - 25648106
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25648158 |
atccccgtgagcttagctcagttggtagggatattgcatattacatgcaggag |
25648106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 39886285 - 39886233
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39886285 |
atccccgtgagcatagctcagttggtagggatattgcatattatatgtaggag |
39886233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 39919166 - 39919114
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39919166 |
atccccgtgagcttagcttagttggtagggatattgcatattatatgcaggag |
39919114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 42525397 - 42525449
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42525397 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcaggag |
42525449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 5900288 - 5900339
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5900288 |
catccccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
5900339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 163 - 210
Target Start/End: Complemental strand, 25472654 - 25472607
Alignment:
| Q |
163 |
ccccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25472654 |
ccccgtgagcttagctcagttggtagggatattgcatattatatgcag |
25472607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 213
Target Start/End: Complemental strand, 4745947 - 4745897
Alignment:
| Q |
163 |
ccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4745947 |
ccccgtgagcttagctcagttggtagggatattgcatattatatgaaggag |
4745897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 6558798 - 6558848
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6558798 |
atccccgtgagcttagctcaattggtagggatattgcatattatatgcagg |
6558848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 9125660 - 9125710
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9125660 |
atccccgtgagcttagctcagttggtagcgatattgcatattatatgcagg |
9125710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 207
Target Start/End: Original strand, 12891554 - 12891600
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12891554 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
12891600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 13622019 - 13621969
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13622019 |
atccccgtgagcttagctcagttggtagggatatcgcatattatatgcagg |
13621969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 18815345 - 18815395
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18815345 |
atccccgtgagcttagctcagttggtaaggatattgcatattatatgcagg |
18815395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 25400434 - 25400388
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25400434 |
gtgagcatagctcagttggtagggatattgcatattatatgcaggag |
25400388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 16386807 - 16386762
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16386807 |
tgagcttagctcagttggtagggatattgcatattatatgcaggag |
16386762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 161 - 210
Target Start/End: Complemental strand, 29713449 - 29713400
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29713449 |
atccccgtgagcttagctcagttggtagggatattgcctattatatgcag |
29713400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 43580878 - 43580927
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43580878 |
cccgtgaacttagctcagttggtagggatattgcatattatatgcaggag |
43580927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 159 - 211
Target Start/End: Complemental strand, 1269242 - 1269190
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
1269242 |
acatccccgtgagcttagctcaattggtagagatattgcatattatatgcagg |
1269190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 209
Target Start/End: Original strand, 8241047 - 8241095
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8241047 |
atccccatgagcttagctcagttggtagggatattgcatattatatgca |
8241095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 11774532 - 11774480
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||| | |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11774532 |
atccccgtgaccttagctcagtttgtagggatattgcatattatatgcaggag |
11774480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 209
Target Start/End: Original strand, 27798618 - 27798666
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27798618 |
atccctgtgagcatagctcagttggtagggatattgcatattatatgca |
27798666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 32706319 - 32706371
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
32706319 |
atccccgtgagcttagctcagttggtagggatattacatattatatggaggag |
32706371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 209
Target Start/End: Original strand, 40091474 - 40091522
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
40091474 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgca |
40091522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 159 - 213
Target Start/End: Original strand, 988709 - 988764
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagtt-ggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||| || ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
988709 |
acatccccgtgagcttaactcagtttggtagggatattgcatattatatgcaggag |
988764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 15241392 - 15241443
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| ||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
15241392 |
catccccgtgagcttagctcagttgataggaatattgcatattatatgcagg |
15241443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 17666006 - 17666053
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17666006 |
cccgtgagcttagctcagttggtaggaatattgcatattatatgcagg |
17666053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 23292487 - 23292440
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23292487 |
cccgtgagcttagctcagttggtagggatattgcatgttatatgcagg |
23292440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 546803 - 546849
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
546803 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
546849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 831589 - 831639
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
831589 |
atccccgtgagcttagctctgttggtagggatatttcatattatatgcagg |
831639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 8478966 - 8478916
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8478966 |
atccccgtgagtttagttcagttggtagggatattgcatattatatgcagg |
8478916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 10241726 - 10241772
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10241726 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
10241772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 24033074 - 24033124
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24033074 |
atccccgcgagcttagctcagttggtagggatattgcattttatatgcagg |
24033124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 25729513 - 25729463
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
25729513 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
25729463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 33736087 - 33736037
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| |||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33736087 |
atccccgggagcttaactcagttggtagggatattgcatattatatgcagg |
33736037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 41477431 - 41477381
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
41477431 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
41477381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 42916386 - 42916436
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
42916386 |
atccccgtgagcttagctcagttggtagggatattgtatgttatatgcagg |
42916436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 2362971 - 2363016
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2362971 |
cgtgagcttaactcagttggtagggatattgcatattatatgcagg |
2363016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 3198325 - 3198374
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
3198325 |
tccccgtgagcttagctcagttggtagggacattgcataatatatgcagg |
3198374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 6414070 - 6414115
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6414070 |
cgtgagcttaactcagttggtagggatattgcatattatatgcagg |
6414115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 14641179 - 14641130
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| || |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14641179 |
cccgtgagcttaactcaattggtagggatattgcatattatatgcaggag |
14641130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 174 - 211
Target Start/End: Original strand, 30571164 - 30571201
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30571164 |
tagctcagttggtagggatattgcatattatatgcagg |
30571201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 154 - 211
Target Start/End: Original strand, 32423555 - 32423612
Alignment:
| Q |
154 |
ttttgacatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| ||||||||||||| || |||||||| ||||||||||| |||||||||||||| |
|
|
| T |
32423555 |
ttttgtcatccccgtgagcttaactcagttgttagggatattgtatattatatgcagg |
32423612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 176 - 213
Target Start/End: Complemental strand, 42718879 - 42718842
Alignment:
| Q |
176 |
gctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42718879 |
gctcagttggtagggatattgcatattatatgcaggag |
42718842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 159 - 211
Target Start/End: Complemental strand, 8750976 - 8750924
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||| ||||||||| ||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
8750976 |
acattcccgtgagcttagttaagttggtagggatattgcatattatatgcagg |
8750924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 163 - 211
Target Start/End: Complemental strand, 11188753 - 11188705
Alignment:
| Q |
163 |
ccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| ||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
11188753 |
ccccgtgagcttagctcagttgataggaatattgcatattatatgcagg |
11188705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 23188668 - 23188628
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaaccct |
303 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23188668 |
aaaataacctatattacaggaggtaaaacactattaaccct |
23188628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 39165018 - 39165066
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39165018 |
ccgtgagtttagttcagttggtagggatattgcatattatatgcaggag |
39165066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 209
Target Start/End: Original strand, 39780803 - 39780851
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||| ||||||||| |
|
|
| T |
39780803 |
atccccgtgagcgtagctcaattgctagggatattgcattttatatgca |
39780851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 165 - 209
Target Start/End: Complemental strand, 40361648 - 40361604
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40361648 |
ccgtgagtttagctcagttggtagggatattgcatattatatgca |
40361604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 174 - 213
Target Start/End: Original strand, 10404137 - 10404176
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10404137 |
tagctcagttggtaggaatattgcatattatatgcaggag |
10404176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 19985500 - 19985547
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19985500 |
cccgtgaccttagctcagttggtagggatattgcataatatatgcagg |
19985547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 24132933 - 24132984
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| ||||||||||| ||| |||||||| ||||||||||||| |
|
|
| T |
24132933 |
catccccgtgagcttagctcagttgatagagatattgcgtattatatgcagg |
24132984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 174 - 209
Target Start/End: Original strand, 28308244 - 28308279
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28308244 |
tagctcagttggtagggatattgcatattatatgca |
28308279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 35113032 - 35112985
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| ||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
35113032 |
cccgtgagcttagttcagttgatagggatattgcatattatatgcagg |
35112985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 216
Target Start/End: Original strand, 4067980 - 4068034
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcg |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||| | |||||||| |||||||| |||| |
|
|
| T |
4067980 |
tccccgtgagcttagctcagttggtagggacaatgcatattttatgcagggggcg |
4068034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 6526047 - 6526097
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
6526047 |
atccccgtgagtttagctcagttggtagagatattggatattatatgcagg |
6526097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 11786129 - 11786083
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11786129 |
ccgtgagcttaactcagttggtagggatattgcattttatatgcagg |
11786083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 16971619 - 16971669
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||| |||||||| ||||| |
|
|
| T |
16971619 |
atccccgtgagcttagctcagttggtagagatattgtatattataggcagg |
16971669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 17064931 - 17064881
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||| ||||||| || |||| |||||||||||||||||||||||||||||| |
|
|
| T |
17064931 |
atcctcgtgagcttaactcaattggtagggatattgcatattatatgcagg |
17064881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 160 - 206
Target Start/End: Complemental strand, 22569318 - 22569272
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
|||||| |||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
22569318 |
catccctgtgagcttagctcagttggtaggcatattgcatattatat |
22569272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 207
Target Start/End: Original strand, 26912830 - 26912876
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||| || |||| |||||||||||||||||||||||||| |
|
|
| T |
26912830 |
atccccgtgagcttaactcaattggtagggatattgcatattatatg |
26912876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 29154846 - 29154892
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
29154846 |
gtgagcttagctcagttggtagggatagtgcatattatatgtaggag |
29154892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 35241397 - 35241443
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
35241397 |
ccgtgagcttagttcagttggtagagatattgcatattatatgcagg |
35241443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 36124400 - 36124446
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| ||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
36124400 |
ccgtgagcttagctcagttgataggaatattgcatattatatgcagg |
36124446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 40081875 - 40081925
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||| ||| ||||||||||| |
|
|
| T |
40081875 |
atccccgtgagcttagctcagttggtagagatattacatcttatatgcagg |
40081925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 161 - 210
Target Start/End: Complemental strand, 3712139 - 3712090
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||||||| ||| ||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
3712139 |
atccccgtaagcttagctcagttggtagagatattgcattttatatgcag |
3712090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 16891348 - 16891393
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
16891348 |
cgtgagcttagctcagttggtagggatattgcattttatatacagg |
16891393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 160 - 213
Target Start/End: Complemental strand, 21962179 - 21962126
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||| || ||||||||| |||||||||||| ||||||||| |||| |
|
|
| T |
21962179 |
catccccgtgagcttaactcagttggcagggatattgcaaattatatgcgggag |
21962126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 178 - 211
Target Start/End: Original strand, 29045901 - 29045934
Alignment:
| Q |
178 |
tcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
29045901 |
tcagttggtagggatattgcatattatatgcagg |
29045934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 158 - 211
Target Start/End: Complemental strand, 33433995 - 33433942
Alignment:
| Q |
158 |
gacatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| | ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
33433995 |
gacatccccgtgaacttagctcagttggtagaaatattgcatattatatacagg |
33433942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 161 - 218
Target Start/End: Original strand, 37034803 - 37034860
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgga |
218 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||| |||| ||||||||||||| |||| |
|
|
| T |
37034803 |
atccccatgagcttagctcaattggtagggatatcgcattttatatgcaggagccgga |
37034860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 40276502 - 40276465
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40276502 |
tagctcagttggtaggaatattgcatattatatgcagg |
40276465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 41156332 - 41156377
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||| |||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
41156332 |
tgagcttagctcggttgatagggatattgcatattatatgcaggag |
41156377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 263 - 304
Target Start/End: Complemental strand, 41797542 - 41797501
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaaccctt |
304 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
41797542 |
aaaataacctatactacaggaggtaaaacactattaaccctt |
41797501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 159 - 207
Target Start/End: Complemental strand, 11146604 - 11146556
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||||| ||||||||||| || ||||||||||| ||||||| |
|
|
| T |
11146604 |
acatccccgtgagcttagctcagttgataaggatattgcatgttatatg |
11146556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 18928723 - 18928767
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
18928723 |
gtgagcttagctcagttggtagggatattgcataatttatgcagg |
18928767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 19273272 - 19273225
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19273272 |
atccccgtgagcg---ctcagttggtagggatattgcatgttatatgcagg |
19273225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 31074200 - 31074148
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||| ||| ||||||| ||||| |
|
|
| T |
31074200 |
atccccgtgagcttaactcagttggtagggatattacattttatatgtaggag |
31074148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 174 - 218
Target Start/End: Complemental strand, 32389694 - 32389650
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcaggaggcgga |
218 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||| |||| |
|
|
| T |
32389694 |
tagctcagttggtagagatattgcatattatatgtaggagtcgga |
32389650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 1670394 - 1670441
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| || ||||||||||||||||| |||||||||||||||| |
|
|
| T |
1670394 |
cccgtgagcttatatcagttggtagggatatggcatattatatgcagg |
1670441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 210
Target Start/End: Original strand, 6119866 - 6119909
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
6119866 |
gtgagcttagctcagttggaagggatattgcattttatatgcag |
6119909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 24477825 - 24477872
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
24477825 |
cccgtgagcttagctcagttggtagggacgttgcataatatatgcagg |
24477872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 264 - 303
Target Start/End: Complemental strand, 34309413 - 34309374
Alignment:
| Q |
264 |
aaataacctatattacagaaggtaaaacactattaaccct |
303 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
34309413 |
aaatgacctatattatagaaggtaaaacactattaaccct |
34309374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 168 - 211
Target Start/End: Complemental strand, 36716924 - 36716881
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| || ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36716924 |
tgagcttaactcagctggtagggatattgcatattatatgcagg |
36716881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 174 - 209
Target Start/End: Complemental strand, 39028093 - 39028058
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39028093 |
tagctcatttggtagggatattgcatattatatgca |
39028058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 207
Target Start/End: Original strand, 1469726 - 1469768
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
1469726 |
ccgtgagtttagctcagttggtagagatattgcatattatatg |
1469768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 4393857 - 4393903
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| ||| ||||||||||||||| |||||| ||||||||||| |
|
|
| T |
4393857 |
ccgtgagcttagttcagttggtagggatgttgcattttatatgcagg |
4393903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 160 - 210
Target Start/End: Complemental strand, 9688746 - 9688696
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||||||||| ||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
9688746 |
catccccgtgagcttagcttagtttgtagaaatattgcatattatatgcag |
9688696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 211
Target Start/End: Complemental strand, 17175108 - 17175074
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17175108 |
ctcagttggtagggatattgcatgttatatgcagg |
17175074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 211
Target Start/End: Original strand, 18638603 - 18638645
Alignment:
| Q |
169 |
gagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||| ||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
18638603 |
gagcttagctcagttggtagggatatcgcattttatatgcagg |
18638645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 203
Target Start/End: Complemental strand, 18993534 - 18993492
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatatta |
203 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||| ||||||| |
|
|
| T |
18993534 |
atccccgtgagcttagctcagttgatagggatattacatatta |
18993492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 19891499 - 19891449
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||| ||||||| || ||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
19891499 |
atcctcgtgagcttaactcagttggtaaggatattgcattttatatgcagg |
19891449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 207
Target Start/End: Original strand, 20719735 - 20719781
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||| ||| || ||||||||||||||||||| ||||||| |
|
|
| T |
20719735 |
atccccgtgagcttagatctgttggtagggatattgcattttatatg |
20719781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 263 - 305
Target Start/End: Complemental strand, 25962841 - 25962799
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaacccttt |
305 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25962841 |
aaaatgacctatattacagggggtaaaacactattaacccttt |
25962799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 27241642 - 27241688
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| |||||||||| ||||| ||||| ||||||||||||||| |
|
|
| T |
27241642 |
ccgtgagcttagctcagtttgtaggaatattacatattatatgcagg |
27241688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 263 - 305
Target Start/End: Original strand, 31312789 - 31312831
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaacccttt |
305 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31312789 |
aaaatgacctatattacagggggtaaaacactattaacccttt |
31312831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 264 - 302
Target Start/End: Complemental strand, 31920098 - 31920060
Alignment:
| Q |
264 |
aaataacctatattacagaaggtaaaacactattaaccc |
302 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31920098 |
aaataacctatattacagggggtaaaacactattaaccc |
31920060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 211
Target Start/End: Original strand, 38097285 - 38097319
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38097285 |
ctcagttggtatggatattgcatattatatgcagg |
38097319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 164 - 206
Target Start/End: Original strand, 42158882 - 42158924
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
||||||| | |||||||||| |||||||||||||||||||||| |
|
|
| T |
42158882 |
cccgtgaacttagctcagtttgtagggatattgcatattatat |
42158924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 207
Target Start/End: Original strand, 42885830 - 42885872
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||| ||||| ||||||||| |||||||||||||||||| |
|
|
| T |
42885830 |
ccgtgagcttagctaagttggtagagatattgcatattatatg |
42885872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 211
Target Start/End: Complemental strand, 4238364 - 4238331
Alignment:
| Q |
178 |
tcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
4238364 |
tcagttggtatggatattgcatattatatgcagg |
4238331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 264 - 305
Target Start/End: Complemental strand, 4413965 - 4413924
Alignment:
| Q |
264 |
aaataacctatattacagaaggtaaaacactattaacccttt |
305 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4413965 |
aaatgacctatattacagggggtaaaacactattaacccttt |
4413924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 5555345 - 5555394
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| |||||||||||||||| | |||||||| | |||||||| |
|
|
| T |
5555345 |
tccccgtgagcatagctcagttggtaggtacattgcataatttatgcagg |
5555394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 177 - 210
Target Start/End: Complemental strand, 7845070 - 7845037
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
7845070 |
ctcagttgctagggatattgcatattatatgcag |
7845037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 264 - 305
Target Start/End: Original strand, 12148245 - 12148286
Alignment:
| Q |
264 |
aaataacctatattacagaaggtaaaacactattaacccttt |
305 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12148245 |
aaatgacctatattacagggggtaaaacactattaacccttt |
12148286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 18755986 - 18756035
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| || |||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
18755986 |
cccgtgagcttaactcagttggtagagatatcgcattttatatgcaggag |
18756035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 22229022 - 22228985
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
22229022 |
tagctcagttggtatggatattgcatgttatatgcagg |
22228985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 264 - 305
Target Start/End: Complemental strand, 30907396 - 30907355
Alignment:
| Q |
264 |
aaataacctatattacagaaggtaaaacactattaacccttt |
305 |
Q |
| |
|
||||||||||||||||| | | |||||||||||||||||||| |
|
|
| T |
30907396 |
aaataacctatattacaaaggttaaaacactattaacccttt |
30907355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 264 - 301
Target Start/End: Original strand, 30916816 - 30916853
Alignment:
| Q |
264 |
aaataacctatattacagaaggtaaaacactattaacc |
301 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
30916816 |
aaatgacctatattacagagggtaaaacactattaacc |
30916853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 180 - 213
Target Start/End: Original strand, 37182559 - 37182592
Alignment:
| Q |
180 |
agttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
37182559 |
agttggtagggatatcgcatattatatgcaggag |
37182592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 40098794 - 40098757
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
40098794 |
tagctcagttgttaggaatattgcatattatatgcagg |
40098757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 42842945 - 42842904
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||| ||||||||| |
|
|
| T |
42842945 |
ccgtgagcttagctcagttggtagagatattgtatattatat |
42842904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 272 - 304
Target Start/End: Original strand, 8855709 - 8855741
Alignment:
| Q |
272 |
tatattacagaaggtaaaacactattaaccctt |
304 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
8855709 |
tatattacaggaggtaaaacactattaaccctt |
8855741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 209
Target Start/End: Original strand, 11017170 - 11017218
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||| |||||| |||||||||||||||||||| |||||| |||||||| |
|
|
| T |
11017170 |
atccgcgtgagtttagctcagttggtagggataatgcataatatatgca |
11017218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 177 - 213
Target Start/End: Complemental strand, 11815666 - 11815630
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11815666 |
ctcagttgaaagggatattgcatattatatgcaggag |
11815630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 209
Target Start/End: Complemental strand, 17242747 - 17242699
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||||| |||||||||||| | ||||| |||||| |||||||| |
|
|
| T |
17242747 |
atccccgtgagcatagctcagttggcaaggataatgcatagtatatgca |
17242699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 164 - 200
Target Start/End: Complemental strand, 18049691 - 18049655
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcata |
200 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
18049691 |
cccgtgagcttagctcaattggtagggatattgcata |
18049655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 166 - 206
Target Start/End: Complemental strand, 20370192 - 20370152
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||| ||||| |
|
|
| T |
20370192 |
cgtgagcttagctcagttggtagggataatgcataatatat |
20370152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 21039904 - 21039864
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaaccct |
303 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
21039904 |
aaaatgacctatattacagggggtaaaacactattaaccct |
21039864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 217
Target Start/End: Original strand, 27498581 - 27498637
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgg |
217 |
Q |
| |
|
|||| ||||||| |||||| |||||||||||||||||||| | ||| ||||||||| |
|
|
| T |
27498581 |
atcctcgtgagcttagctcggttggtagggatattgcataatgtatataggaggcgg |
27498637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 264 - 304
Target Start/End: Original strand, 37082293 - 37082333
Alignment:
| Q |
264 |
aaataacctatattacagaaggtaaaacactattaaccctt |
304 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37082293 |
aaattacctatattacagggggtaaaacactattaaccctt |
37082333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 211
Target Start/End: Complemental strand, 41319506 - 41319474
Alignment:
| Q |
179 |
cagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
41319506 |
cagttggtagggatattgcattttatatgcagg |
41319474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 174)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 19996525 - 19996473
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19996525 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
19996473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 153 - 211
Target Start/End: Complemental strand, 28550400 - 28550342
Alignment:
| Q |
153 |
tttttgacatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28550400 |
tttttaacatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
28550342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 159 - 213
Target Start/End: Complemental strand, 31327576 - 31327522
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31327576 |
acatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
31327522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 159 - 213
Target Start/End: Complemental strand, 31327793 - 31327739
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31327793 |
acatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
31327739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 159 - 213
Target Start/End: Complemental strand, 52410316 - 52410262
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52410316 |
acatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
52410262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 160 - 213
Target Start/End: Original strand, 40548299 - 40548352
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40548299 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
40548352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 882386 - 882438
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
882386 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
882438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 7269952 - 7270004
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7269952 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
7270004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 19550503 - 19550555
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19550503 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
19550555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 37800684 - 37800632
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37800684 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
37800632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 40933904 - 40933852
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40933904 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
40933852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 44652055 - 44652003
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44652055 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
44652003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 45701341 - 45701393
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45701341 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
45701393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 50496887 - 50496835
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50496887 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
50496835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 19999863 - 19999914
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19999863 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
19999914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 52945891 - 52945942
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52945891 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
52945942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 163 - 213
Target Start/End: Complemental strand, 6920034 - 6919984
Alignment:
| Q |
163 |
ccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6920034 |
ccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
6919984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 22502004 - 22501954
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22502004 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
22501954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 39966147 - 39966097
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39966147 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
39966097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 53347363 - 53347313
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53347363 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
53347313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 4139000 - 4139049
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4139000 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
4139049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 161 - 210
Target Start/End: Original strand, 40192153 - 40192202
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40192153 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcag |
40192202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 160 - 213
Target Start/End: Complemental strand, 52974127 - 52974074
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52974127 |
catccccgtgagcttaactcagttggtagggatattgcatattatatgcaggag |
52974074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 2390427 - 2390375
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2390427 |
atccccgtaagcgtagctcagttgatagggatattgcatattatatgcaggag |
2390375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 209
Target Start/End: Original strand, 2522923 - 2522971
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2522923 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgca |
2522971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 209
Target Start/End: Original strand, 7920317 - 7920365
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7920317 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgca |
7920365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 10176976 - 10176924
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10176976 |
atccccgtgaggttagctcagttggtagggatattgcatattatatgcaggag |
10176924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 10482926 - 10482874
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10482926 |
atccccgtgaacttagctcagttggtagggatattgcatattatatgcaggag |
10482874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 15975149 - 15975201
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15975149 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
15975201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 18194335 - 18194387
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18194335 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcaggag |
18194387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 28689745 - 28689693
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28689745 |
atccccgtgaacttagctcagttggtagggatattgcatattatatgcaggag |
28689693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 31529031 - 31528979
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31529031 |
atccccgtgagcttagctcagttggtagggatattgaatattatatgcaggag |
31528979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 159 - 211
Target Start/End: Original strand, 31586942 - 31586994
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31586942 |
acatccccatgagcttagctcagttggtagggatattgcatattatatgcagg |
31586994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 49447135 - 49447187
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49447135 |
atccccgtgagtatagctcagttggtagggatattgcatattatatgcaggag |
49447187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 211
Target Start/End: Complemental strand, 41936481 - 41936430
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41936481 |
catccccgtaagcttagctcagttggtagggatattgcatattatatgcagg |
41936430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 47098732 - 47098779
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47098732 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
47098779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 211
Target Start/End: Complemental strand, 50536906 - 50536855
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50536906 |
catccccgtgagcttagctcagttggtagagatattgcatattatatgcagg |
50536855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 3748675 - 3748625
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3748675 |
atccccgtgagcttagctcagttggtagggatattgtatattatatgcagg |
3748625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 5636866 - 5636820
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5636866 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggag |
5636820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 25939003 - 25938953
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25939003 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcagg |
25938953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 30779640 - 30779590
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30779640 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatgcagg |
30779590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 32256627 - 32256577
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32256627 |
atccccgtgagcttagctcagttggtagggatattgcatgttatatgcagg |
32256577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 34102684 - 34102634
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34102684 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgcagg |
34102634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 34898840 - 34898790
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34898840 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgcagg |
34898790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 46796002 - 46795952
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46796002 |
atccccgtgagcttagctcagttggtagggatattgcattttatatgcagg |
46795952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 48739817 - 48739767
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48739817 |
atccccgtgagcttagctcagttggtagggatattgcattttatatgcagg |
48739767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 213
Target Start/End: Original strand, 50234123 - 50234173
Alignment:
| Q |
163 |
ccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50234123 |
ccccgtgagcttacctcagttggtagggatattgcatattatatgcaggag |
50234173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 207
Target Start/End: Original strand, 53163591 - 53163637
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
53163591 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
53163637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 8125641 - 8125686
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8125641 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagg |
8125686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 164 - 209
Target Start/End: Complemental strand, 9176656 - 9176611
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9176656 |
cccgtgagcttagctcagttggtagggatattgcatattatatgca |
9176611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 32828441 - 32828490
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32828441 |
cccgtgagcttagctcggttggtagggatattgcatattatatgcaggag |
32828490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 160 - 213
Target Start/End: Complemental strand, 33225422 - 33225369
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
33225422 |
catccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggag |
33225369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 36625237 - 36625192
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36625237 |
tgagcttagctcagttggtagggatattgcatattatatgcaggag |
36625192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 8964849 - 8964797
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8964849 |
atccccgtgagtttagctcagttggtagggatattgcatatcatatgcaggag |
8964797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 11820001 - 11820053
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
11820001 |
atccccgtgagcttagctcagttggtagggatattgcatgttatatgtaggag |
11820053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 209
Target Start/End: Original strand, 17218485 - 17218533
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17218485 |
atccccatgagcttagctcagttggtagggatattgcatattatatgca |
17218533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 209
Target Start/End: Complemental strand, 30555300 - 30555252
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30555300 |
atccccgtgagcttagctcagttggtagggatattgcatattaaatgca |
30555252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 32144581 - 32144633
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
32144581 |
atccccgtgagcttagcttagttggtaggggtattgcatattatatgcaggag |
32144633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 48251569 - 48251621
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||| |||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
48251569 |
atccctgtgagcttagctcagttgatagggatattgcatattatatgcaggag |
48251621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 49408772 - 49408824
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
49408772 |
atccccgtgagcttagctcagctggtagggatatcgcatattatatgcaggag |
49408824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 159 - 211
Target Start/End: Complemental strand, 54769905 - 54769853
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| |||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
54769905 |
acatctccgtgagcttagcttagttggtagggatattgcatattatatgcagg |
54769853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 174 - 213
Target Start/End: Complemental strand, 4640540 - 4640501
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4640540 |
tagctcagttggtagggatattgcatattatatgcaggag |
4640501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 26942753 - 26942800
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26942753 |
cccgtaagcttagctcagttggtagggatattgcatattatatgcagg |
26942800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 39719935 - 39719982
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39719935 |
cccgtgagtttagctcagttggtagggatattgcatattatatgcagg |
39719982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 2368933 - 2368983
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||| ||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2368933 |
atcctcgtgagcttagctcagttgttagggatattgcatattatatgcagg |
2368983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 6488121 - 6488171
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| ||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6488121 |
atccccatgagcttagctcaattggtagggatattgcatattatatgcagg |
6488171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 17608392 - 17608342
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| || || |||||||||||||||||||||||||||||||| |
|
|
| T |
17608392 |
atccccgtgagcttaacttagttggtagggatattgcatattatatgcagg |
17608342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 34847540 - 34847590
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
34847540 |
atccccgtgagcttaattcagttggtagggatattgcatattatatgcagg |
34847590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 37488533 - 37488483
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
37488533 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
37488483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 45871014 - 45871064
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45871014 |
atccccgtgagtttagctcagttggtagggatattgtatattatatgcagg |
45871064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 213
Target Start/End: Complemental strand, 52309181 - 52309131
Alignment:
| Q |
163 |
ccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52309181 |
ccccgtgagcttaactcagttggtagggatattgcatactatatgcaggag |
52309131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 53752773 - 53752723
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| || |||||||||||||||||| |||||||||||||||| |
|
|
| T |
53752773 |
atccccgtgagcttaactcagttggtagggatatggcatattatatgcagg |
53752723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 3894544 - 3894593
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| ||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3894544 |
cccgtgagcttagttcagttggtatggatattgcatattatatgcaggag |
3894593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 11250651 - 11250614
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11250651 |
tagctcagttggtagggatattgcatattatatgcagg |
11250614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 166 - 207
Target Start/End: Complemental strand, 17602744 - 17602703
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17602744 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
17602703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 161 - 210
Target Start/End: Original strand, 44364018 - 44364067
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
44364018 |
atccccgtgagtttaactcagttggtagggatattgcatattatatgcag |
44364067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 166 - 211
Target Start/End: Complemental strand, 49750474 - 49750429
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49750474 |
cgtgagcttagctcagttgatagggatattgcatattatatgcagg |
49750429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 209
Target Start/End: Complemental strand, 22472387 - 22472339
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||||| || |||||||||||| |||||||||||||||||||| |
|
|
| T |
22472387 |
atccccgtgagcttaactcagttggtagagatattgcatattatatgca |
22472339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 157 - 213
Target Start/End: Original strand, 31922349 - 31922405
Alignment:
| Q |
157 |
tgacatccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||||| | ||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
31922349 |
tgacatccccgtgagcttgtctcagttggtaagaatattgcatattatatgcaggag |
31922405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 209
Target Start/End: Complemental strand, 33706800 - 33706752
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
33706800 |
atccccgtgagcttagctcaattggtagggatattacatattatatgca |
33706752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 174 - 210
Target Start/End: Complemental strand, 42108242 - 42108206
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42108242 |
tagctcagttggtagggatattgcatattatatgcag |
42108206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 54021401 - 54021357
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54021401 |
gtgagcttagctcagttggtatggatattgcatattatatgcagg |
54021357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 4541898 - 4541945
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
4541898 |
cccgtgagcttagttcagttggtagggatattgtatattatatgcagg |
4541945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 4860161 - 4860208
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
4860161 |
cccgtgagcttagctcagttggtacggatattgcattttatatgcagg |
4860208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 211
Target Start/End: Complemental strand, 8762154 - 8762103
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| || || |||||||||||||||| ||||||||||||||| |
|
|
| T |
8762154 |
catccccgtgagcttaacttagttggtagggatattacatattatatgcagg |
8762103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 168 - 211
Target Start/End: Original strand, 20489819 - 20489862
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20489819 |
tgagcttagctcagttggtagggttattgcatattatatgcagg |
20489862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 29373519 - 29373472
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| || ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29373519 |
cccgtgagcttaactcagttggtaaggatattgcatattatatgcagg |
29373472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 164 - 207
Target Start/End: Original strand, 48546173 - 48546216
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
48546173 |
cccgtgagcttagctcagttggtagtgatattgcatattatatg |
48546216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 164 - 207
Target Start/End: Complemental strand, 52670223 - 52670180
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
52670223 |
cccgtgagcttagttcagttggtagggatattgcatattatatg |
52670180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 52984000 - 52984055
Alignment:
| Q |
154 |
ttttgacatccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||| || || |||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52984000 |
ttttgatattcctgtgagcttagctcagttggtagggatattgcatattgtatgca |
52984055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 177 - 211
Target Start/End: Complemental strand, 4200642 - 4200608
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4200642 |
ctcagttggtagggatattgcatattatatgcagg |
4200608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 164 - 210
Target Start/End: Original strand, 4880169 - 4880215
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
4880169 |
cccgtgagcttagctcagttggtacggatattgcattttatatgcag |
4880215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 159 - 201
Target Start/End: Original strand, 10349400 - 10349442
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatat |
201 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
10349400 |
acatccccgtgagcttagctcagttgatagggatattgcatat |
10349442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 177 - 211
Target Start/End: Original strand, 11436517 - 11436551
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
11436517 |
ctcagttggtagggatattgcatattatatgcagg |
11436551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 207
Target Start/End: Complemental strand, 13638318 - 13638272
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||| ||||||||||| |
|
|
| T |
13638318 |
atccccgtgagcttagttcagttggtagggatattacatattatatg |
13638272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 164 - 210
Target Start/End: Original strand, 24430146 - 24430192
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
24430146 |
cccgtgagcttagctcagttggtagagatattgtatattatatgcag |
24430192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 28193795 - 28193845
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| ||||| || ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28193795 |
atccccttgagcttaactcagttggtagggatattgcattttatatgcagg |
28193845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 160 - 206
Target Start/End: Complemental strand, 44685242 - 44685196
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
||||||||||||| ||||| ||||||||| ||||||||||||||||| |
|
|
| T |
44685242 |
catccccgtgagcttagcttagttggtagagatattgcatattatat |
44685196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 207
Target Start/End: Complemental strand, 45551882 - 45551836
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||| ||||||| |
|
|
| T |
45551882 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatg |
45551836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 164 - 206
Target Start/End: Complemental strand, 52046455 - 52046413
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
52046455 |
cccgtgagcttagctcagttggtagggatattgcattttatat |
52046413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 177 - 211
Target Start/End: Complemental strand, 53432794 - 53432760
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
53432794 |
ctcagttggtagggatattgcatattatatgcagg |
53432760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 167 - 209
Target Start/End: Original strand, 53577958 - 53578000
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
53577958 |
gtgagcttagctcagttggtagggatgttgcatattatatgca |
53578000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 164 - 209
Target Start/End: Complemental strand, 5326106 - 5326061
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
5326106 |
cccgtgagcttagctcagttggtagcgatattgcatattacatgca |
5326061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 161 - 206
Target Start/End: Original strand, 31316631 - 31316676
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||| ||||||||| |
|
|
| T |
31316631 |
atccccgtgagcttagctcagttgatagggatattgtatattatat |
31316676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 164 - 201
Target Start/End: Original strand, 34757529 - 34757566
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatat |
201 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34757529 |
cccgtgagcttagctcagttggtagggatattgcatat |
34757566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 36763427 - 36763476
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| | |||||||||||||||| |||||||| |||||||||| |
|
|
| T |
36763427 |
tccccgtgagcttggctcagttggtagggacattgcataatatatgcagg |
36763476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 178 - 211
Target Start/End: Original strand, 42268798 - 42268831
Alignment:
| Q |
178 |
tcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42268798 |
tcagttggtagggatattgcatattatatgcagg |
42268831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 52575461 - 52575510
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| |||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
52575461 |
tccccgtgagcttagctcagttggtacgaatattgcattttatatgcagg |
52575510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 2007156 - 2007104
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||| | || |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2007156 |
atccccgtgaacttaactcagttggtagaaatattgcatattatatgcaggag |
2007104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 11234439 - 11234491
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||| |||| ||||||| || ||||||||||||| |
|
|
| T |
11234439 |
atccccgtgagcttagctcagttagtagagatattgtattttatatgcaggag |
11234491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 25833824 - 25833872
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||| ||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25833824 |
ccgttagcttagctcagttggtaaagatattgcatattatatgcaggag |
25833872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 177 - 213
Target Start/End: Complemental strand, 31673306 - 31673270
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31673306 |
ctcagttggtaaggatattgcatattatatgcaggag |
31673270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 161 - 205
Target Start/End: Original strand, 39300381 - 39300425
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattata |
205 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||| ||||| |
|
|
| T |
39300381 |
atccccgtgagcttagctcagttggtagggatattacattttata |
39300425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 45513068 - 45513016
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||| ||| |||||||||| ||| |||||||||||||||||| |||||| |
|
|
| T |
45513068 |
atccccgtaagcttagctcagttagtatggatattgcatattatatacaggag |
45513016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 210
Target Start/End: Original strand, 46879999 - 46880043
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
46879999 |
cgtgagcttagctcagttgatagggatattgcattttatatgcag |
46880043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 51772892 - 51772936
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| || || |||||||||||||||||||||||||||||||| |
|
|
| T |
51772892 |
gtgagcttaacttagttggtagggatattgcatattatatgcagg |
51772936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 207
Target Start/End: Complemental strand, 12894600 - 12894557
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||| ||||||| |
|
|
| T |
12894600 |
cccgtgagcttaactcagttggtagggatattgcattttatatg |
12894557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 262 - 305
Target Start/End: Complemental strand, 20078397 - 20078354
Alignment:
| Q |
262 |
aaaaataacctatattacagaaggtaaaacactattaacccttt |
305 |
Q |
| |
|
||||||||| |||||| ||| ||||||||||||||||||||||| |
|
|
| T |
20078397 |
aaaaataacttatattgcaggaggtaaaacactattaacccttt |
20078354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 25279133 - 25279086
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||| ||||||| ||||| ||||||||||||||||| |||||||||| |
|
|
| T |
25279133 |
catcctcgtgagcttagcttagttggtagggatattgtatattatatg |
25279086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 168 - 211
Target Start/End: Complemental strand, 28396848 - 28396805
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| || ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28396848 |
tgagcttaactcagttggtagggatattgcatgttatatgcagg |
28396805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 168 - 207
Target Start/End: Complemental strand, 29559740 - 29559701
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
29559740 |
tgagcttaactcagttggtagggatattgcatattatatg |
29559701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 33607009 - 33606962
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| | ||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
33607009 |
cccgtgaacttagctcaattggtagggatattgcattttatatgcagg |
33606962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 174 - 209
Target Start/End: Original strand, 34740297 - 34740332
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34740297 |
tagcccagttggtagggatattgcatattatatgca |
34740332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 168 - 211
Target Start/End: Original strand, 37112814 - 37112857
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
37112814 |
tgagcttagctcagttggtaaggatattgcattttatatgcagg |
37112857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 161 - 208
Target Start/End: Complemental strand, 40723733 - 40723686
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgc |
208 |
Q |
| |
|
||||||| |||| || ||||||||||||||||||||||| |||||||| |
|
|
| T |
40723733 |
atccccgagagcttaactcagttggtagggatattgcatgttatatgc |
40723686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 213
Target Start/End: Complemental strand, 51152683 - 51152648
Alignment:
| Q |
178 |
tcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51152683 |
tcagttggtagggatgttgcatattatatgcaggag |
51152648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 167 - 209
Target Start/End: Original strand, 552174 - 552216
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
552174 |
gtgagcttaactcagttggtagggatattgcataatatatgca |
552216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 207
Target Start/End: Complemental strand, 1743870 - 1743824
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||| || |||| |||||||||||||||||| ||||||| |
|
|
| T |
1743870 |
atccccgtgagcttaactcaattggtagggatattgcattttatatg |
1743824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 160 - 206
Target Start/End: Original strand, 2151053 - 2151099
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
||||| |||||||||||||||||||||||||| | |||||| ||||| |
|
|
| T |
2151053 |
catcctcgtgagcgtagctcagttggtagggacaatgcataatatat |
2151099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 262 - 300
Target Start/End: Complemental strand, 2830067 - 2830029
Alignment:
| Q |
262 |
aaaaataacctatattacagaaggtaaaacactattaac |
300 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
2830067 |
aaaaatgacctatattacagaaggtaaaacaccattaac |
2830029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 263 - 305
Target Start/End: Original strand, 14220704 - 14220746
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaacccttt |
305 |
Q |
| |
|
||||| |||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
14220704 |
aaaatgacctatattacagagggtaaaatactattaacccttt |
14220746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 263 - 305
Target Start/End: Original strand, 14224931 - 14224973
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaacccttt |
305 |
Q |
| |
|
||||| |||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
14224931 |
aaaatgacctatattacagagggtaaaatactattaacccttt |
14224973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 20887838 - 20887792
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
20887838 |
ccgtgagtttagctcagttggtagggatattgcataatttatgcagg |
20887792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 29098689 - 29098739
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| | || |||||||||||| ||||||| |||||||||||||| |
|
|
| T |
29098689 |
atccccgtgaacttaactcagttggtagagatattgtatattatatgcagg |
29098739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 36666458 - 36666508
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||| |||||||| ||| |||||| |||||||||||||| |
|
|
| T |
36666458 |
atccccgtgagcttagttcagttggcaggaatattgtatattatatgcagg |
36666508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 263 - 305
Target Start/End: Complemental strand, 38703021 - 38702979
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaacccttt |
305 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
38703021 |
aaaataacctatattacccagggtaaaacactattaacccttt |
38702979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 38819396 - 38819346
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| ||| | ||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
38819396 |
atccccatgaacttagcttagttggtagggatatttcatattatatgcagg |
38819346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 40963784 - 40963734
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| || |||||||| || ||||||||||| ||||||||||| |
|
|
| T |
40963784 |
atccccgtgagcttaactcagttgataaggatattgcattttatatgcagg |
40963734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 211
Target Start/End: Original strand, 44106615 - 44106649
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
44106615 |
ctcagttgctagggatattgcatattatatgcagg |
44106649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 207
Target Start/End: Original strand, 45198724 - 45198766
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||| ||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
45198724 |
ccgttagcttagttcagttggtagggatattgcatattatatg |
45198766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 211
Target Start/End: Complemental strand, 50675799 - 50675765
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
50675799 |
ctcagttggtagggatattgcatattatatacagg |
50675765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 207
Target Start/End: Complemental strand, 50727317 - 50727271
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||| || |||||||||||||||||| |||| ||||||| |
|
|
| T |
50727317 |
atccccgtgagcctaactcagttggtagggatatcgcattttatatg |
50727271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 207
Target Start/End: Original strand, 50785531 - 50785577
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||| || |||||||||||||||||| |||| ||||||| |
|
|
| T |
50785531 |
atccccgtgagcctaactcagttggtagggatatcgcattttatatg |
50785577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 51425837 - 51425887
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| || |||||||||||||||||| ||| ||||||||||| |
|
|
| T |
51425837 |
atccccgtgagcttaactcagttggtagggatatcacattttatatgcagg |
51425887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 51467173 - 51467223
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| | ||||||||||| ||||||||| |||| ||||||||||| |
|
|
| T |
51467173 |
atccccgtgaacttagctcagttgatagggatatcgcattttatatgcagg |
51467223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 159 - 211
Target Start/End: Complemental strand, 1697923 - 1697870
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcata-ttatatgcagg |
211 |
Q |
| |
|
||||| |||||||| || ||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
1697923 |
acatcaccgtgagcttaactcagttagtagggatattgcatatttatatgcagg |
1697870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 299
Target Start/End: Original strand, 2985829 - 2985866
Alignment:
| Q |
262 |
aaaaataacctatattacagaaggtaaaacactattaa |
299 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
2985829 |
aaaaatgacctatattacagagggtaaaacactattaa |
2985866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 211
Target Start/End: Complemental strand, 4237051 - 4237002
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| ||| |||||||||||||| |||||||| | |||||||| |
|
|
| T |
4237051 |
tccccgtgagcttagttcagttggtagggacattgcataatttatgcagg |
4237002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 8756526 - 8756571
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| || ||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
8756526 |
cgtgagcttaactcagttggtaggaatattgcattttatatgcagg |
8756571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 14795109 - 14795158
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| ||||| ||||||||| || |||||||| |||||||||| |
|
|
| T |
14795109 |
tccccgtgagcttagcttagttggtagtgacattgcataatatatgcagg |
14795158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 210
Target Start/End: Original strand, 15299073 - 15299118
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||| ||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
15299073 |
ccgtgagtttagttcagttggtagggatattgtatattatatgcag |
15299118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 211
Target Start/End: Original strand, 15491863 - 15491900
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15491863 |
tagctcagttggtagaaatattgcatattatatgcagg |
15491900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 161 - 206
Target Start/End: Complemental strand, 16895303 - 16895258
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
||||||| |||| || ||||||||||||| |||||||||||||||| |
|
|
| T |
16895303 |
atccccgagagcttaactcagttggtaggaatattgcatattatat |
16895258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 177 - 210
Target Start/End: Original strand, 22857407 - 22857440
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
22857407 |
ctcagttggtaggaatattgcatattatatgcag |
22857440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 24303388 - 24303437
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| |||||||||||| ||||| |||||||| | |||||||| |
|
|
| T |
24303388 |
tccccgtgagcttagctcagttggcagggacattgcataatttatgcagg |
24303437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 211
Target Start/End: Original strand, 26259139 - 26259176
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
26259139 |
tagctcaattggtagggatatcgcatattatatgcagg |
26259176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 177 - 206
Target Start/End: Complemental strand, 29496163 - 29496134
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29496163 |
ctcagttggtagggatattgcatattatat |
29496134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 44764724 - 44764769
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||| | |||||||| |
|
|
| T |
44764724 |
cgtgagcttagctcagttggtagggacattgcataatttatgcagg |
44764769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 210
Target Start/End: Complemental strand, 44945730 - 44945685
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||||||| || ||||||||||||| ||||||| |||||||||||| |
|
|
| T |
44945730 |
ccgtgagcttatctcagttggtaggaatattgcgtattatatgcag |
44945685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 45118638 - 45118687
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| ||||| |||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
45118638 |
tccccatgagcttagctcagttggtagggacattgcattatatatgcagg |
45118687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 210
Target Start/End: Complemental strand, 46730842 - 46730797
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||||||| ||||||||||| |||| |||| ||||||||||||||| |
|
|
| T |
46730842 |
ccgtgagcttagctcagttgataggcatatagcatattatatgcag |
46730797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 211
Target Start/End: Complemental strand, 54349892 - 54349863
Alignment:
| Q |
182 |
ttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
54349892 |
ttggtagggatattgcatattatatgcagg |
54349863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 16886585 - 16886629
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||| ||| |||| |
|
|
| T |
16886585 |
gtgagcttagctcagttggtagggacattgcatattgtatacagg |
16886629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 166 - 210
Target Start/End: Original strand, 17765579 - 17765623
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||| |||| | |||||||||||||||| ||||||||||||| |
|
|
| T |
17765579 |
cgtgagcttagcccggttggtagggatattgtatattatatgcag |
17765623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 166 - 210
Target Start/End: Original strand, 19066899 - 19066943
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||| |||| | |||||||||||||||| ||||||||||||| |
|
|
| T |
19066899 |
cgtgagcttagcccggttggtagggatattgtatattatatgcag |
19066943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 19591652 - 19591600
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||| ||||| ||||||||||| || | ||||||||||||||||| ||||| |
|
|
| T |
19591652 |
atccccttgagcttagctcagttgataagtatattgcatattatatgtaggag |
19591600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 21405160 - 21405212
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| || ||||||||| ||||||||||||| | ||||| ||||| |
|
|
| T |
21405160 |
atccccgtgagcttacctcagttggaagggatattgcatttaatatgtaggag |
21405212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 27983858 - 27983902
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
27983858 |
gtgagcttagctcagttggtagaaatattgcattttatatgcagg |
27983902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 32776214 - 32776258
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||| | |||||||| |
|
|
| T |
32776214 |
gtgagcttagctcagttggtagggacattgcataatttatgcagg |
32776258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 36834772 - 36834728
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| |||||||| || ||||||||||| |||||||||||||| |
|
|
| T |
36834772 |
gtgagcttagctcagctgatagggatattgtatattatatgcagg |
36834728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 262 - 302
Target Start/End: Original strand, 40066801 - 40066841
Alignment:
| Q |
262 |
aaaaataacctatattacagaaggtaaaacactattaaccc |
302 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||| |||||||| |
|
|
| T |
40066801 |
aaaaataacctatattacggaaggtaaagcaccattaaccc |
40066841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 40910242 - 40910203
Alignment:
| Q |
174 |
tagctcagttggtaggg--atattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40910242 |
tagctcagttggtagggggatattgcatattatatgcagg |
40910203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 43645076 - 43645124
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||| ||||||||||| ||||||||| ||||||||| ||||||| |
|
|
| T |
43645076 |
ccgtgagcttagctcagttgacagggatatttcatattatacgcaggag |
43645124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 178 - 206
Target Start/End: Complemental strand, 52434723 - 52434695
Alignment:
| Q |
178 |
tcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
52434723 |
tcagttggtagggatattgcatattatat |
52434695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 53; Significance: 2e-21; HSPs: 131)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 3438945 - 3438997
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3438945 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
3438997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 160 - 213
Target Start/End: Original strand, 19684069 - 19684122
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19684069 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
19684122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 2643694 - 2643746
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2643694 |
atccccgtgagcatagctcagttggtagggatattgcatattatatgcaggag |
2643746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 3446727 - 3446779
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3446727 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
3446779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 4183173 - 4183225
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4183173 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
4183225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 6331559 - 6331611
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6331559 |
atccccgtgagcatagctcagttggtagggatattgcatattatatgcaggag |
6331611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 19281605 - 19281657
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19281605 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
19281657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 22653717 - 22653665
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22653717 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
22653665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 25857368 - 25857316
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25857368 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
25857316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 217
Target Start/End: Complemental strand, 30932519 - 30932463
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgg |
217 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30932519 |
atccccgtgagcttacctcagttggtagggatattgcatattatatgcaggaggcgg |
30932463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 161 - 212
Target Start/End: Original strand, 18694782 - 18694833
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagga |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18694782 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagga |
18694833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 38400306 - 38400357
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38400306 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
38400357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 8250374 - 8250324
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8250374 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
8250324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 33229006 - 33228956
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33229006 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
33228956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 44948593 - 44948643
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44948593 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
44948643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 160 - 213
Target Start/End: Complemental strand, 18278491 - 18278438
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18278491 |
catccccgtgagtttagctcagttggtagggatattgcatattatatgcaggag |
18278438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 160 - 213
Target Start/End: Original strand, 27297171 - 27297224
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27297171 |
catccccgtgagcttagctcagttggtagggatattgcatattgtatgcaggag |
27297224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 4562825 - 4562773
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4562825 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcaggag |
4562773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 17034732 - 17034784
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17034732 |
atccccgtgagcttagctcaattggtagggatattgcatattatatgcaggag |
17034784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 17078454 - 17078506
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17078454 |
atccccgtgagcttagctcagttggtagggatattgtatattatatgcaggag |
17078506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 33233295 - 33233243
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33233295 |
atccccgtgagcttatctcagttggtagggatattgcatattatatgcaggag |
33233243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 163 - 211
Target Start/End: Original strand, 34613978 - 34614026
Alignment:
| Q |
163 |
ccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34613978 |
ccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
34614026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 36005439 - 36005491
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36005439 |
atccccgtgagcgtaactcaattggtagggatattgcatattatatgcaggag |
36005491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 41509517 - 41509565
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41509517 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
41509565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 15764926 - 15764977
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15764926 |
catcctcgtgagcttagctcagttggtagggatattgcatattatatgcagg |
15764977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 36182644 - 36182691
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36182644 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
36182691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 1844814 - 1844864
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1844814 |
atccccgtaagcttagctcagttggtagggatattgcatattatatgcagg |
1844864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 2289607 - 2289657
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2289607 |
atccccgtgagcttagctcagttggtaggaatattgcatattatatgcagg |
2289657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 5521293 - 5521243
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5521293 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgcagg |
5521243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 11050830 - 11050780
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11050830 |
atccccgtgagcttagctcagttggtagggatattacatattatatgcagg |
11050780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 15233410 - 15233460
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15233410 |
atccccgtgagcttagctcaattggtagggatattgcatattatatgcagg |
15233460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 40535522 - 40535472
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40535522 |
atccccgtgagcttagctcagttggtacggatattgcatattatatgcagg |
40535472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 44857307 - 44857257
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44857307 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatgcagg |
44857257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 263 - 304
Target Start/End: Original strand, 1975818 - 1975859
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaaccctt |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1975818 |
aaaataacctatattacagaaggtaaaacactattaaccctt |
1975859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 160 - 213
Target Start/End: Original strand, 20296414 - 20296467
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||| ||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
20296414 |
catccccgtgagcttagctcagttgataaggatattgcatattatatgcaggag |
20296467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 41566760 - 41566809
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41566760 |
tccccgtgagcttagctcagttggtaggaatattgcatattatatgcagg |
41566809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 209
Target Start/End: Complemental strand, 466679 - 466631
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
466679 |
atccccgtgagcatagctcagttggtagggatattacatattatatgca |
466631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 1071467 - 1071519
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
1071467 |
atccccgtgagcttagctcagttggtatggatattgtatattatatgcaggag |
1071519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 1260181 - 1260233
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagga |
212 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
1260181 |
catccccgtgagcttagctcagttggtagggatattgcatgttatatgtagga |
1260233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 159 - 211
Target Start/End: Complemental strand, 3287131 - 3287079
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| |||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3287131 |
acatccctgtgagcttagctcagttggaagggatattgcatattatatgcagg |
3287079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 5474903 - 5474955
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
5474903 |
atccccgtgagcttagctcagttggcagggatattgcatattatacgcaggag |
5474955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 6636034 - 6635990
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6636034 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
6635990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 15485659 - 15485711
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
15485659 |
atccccgtgagcttagctcagttggtaaggatattgcatattatatgctggag |
15485711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 209
Target Start/End: Complemental strand, 27497601 - 27497553
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27497601 |
atccccgtgagcatagctcagttggtagggatattgcatgttatatgca |
27497553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 209
Target Start/End: Complemental strand, 28195207 - 28195159
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28195207 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatgca |
28195159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 209
Target Start/End: Complemental strand, 39408763 - 39408715
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
39408763 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgca |
39408715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 44822420 - 44822472
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
44822420 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggag |
44822472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 159 - 206
Target Start/End: Original strand, 5062292 - 5062339
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
5062292 |
acatccccgtgagcttaactcagttggtagggatattgcatattatat |
5062339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 27913539 - 27913492
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27913539 |
cccgtgagcttagctcaattggtagggatattgcatattatatgcagg |
27913492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 28194628 - 28194679
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| ||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28194628 |
catccccatgagcttagctcagttgctagggatattgcatattatatgcagg |
28194679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 174 - 213
Target Start/End: Complemental strand, 30390429 - 30390390
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30390429 |
tagctcagttggtagggatattgcatattatatgcaggag |
30390390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 160 - 210
Target Start/End: Complemental strand, 7379674 - 7379624
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||||||||| || ||||||||||| |||||||||||||||||||||| |
|
|
| T |
7379674 |
catccccgtgagcttaactcagttggtaaggatattgcatattatatgcag |
7379624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 38525626 - 38525576
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
38525626 |
atccccgtgagcttagctcagttggtaaggatattgcattttatatgcagg |
38525576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 174 - 211
Target Start/End: Original strand, 1500971 - 1501008
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1500971 |
tagctcagttggtagggatattgcatattatatgcagg |
1501008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 210
Target Start/End: Original strand, 17487705 - 17487750
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17487705 |
ccgtgaacttagctcagttggtagggatattgcatattatatgcag |
17487750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 19612715 - 19612764
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19612715 |
cccgtgagcttagttcagttggtagggatattgcatattatatgtaggag |
19612764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 160 - 213
Target Start/End: Complemental strand, 22718135 - 22718082
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| || |||||||||||||||| |
|
|
| T |
22718135 |
catccccgtgagcttaactcagttggtagggatactgtatattatatgcaggag |
22718082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 23405194 - 23405243
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
23405194 |
tccccgtgagcttagctcagttggtagggacattgcataatatatgcagg |
23405243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 164 - 209
Target Start/End: Original strand, 27449183 - 27449228
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27449183 |
cccgtgagcatagctcagttggtagggatattgcattttatatgca |
27449228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 30392898 - 30392853
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30392898 |
tgagcttagctcagttggtagggatattgcatattatatgtaggag |
30392853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 175 - 211
Target Start/End: Complemental strand, 7281747 - 7281711
Alignment:
| Q |
175 |
agctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7281747 |
agctcagttggtagggatattgcatattatatgcagg |
7281711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 209
Target Start/End: Original strand, 18803208 - 18803256
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||||| ||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
18803208 |
atccccgtgagcttagctcacttggtaggaatattgcatattatatgca |
18803256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 165 - 209
Target Start/End: Complemental strand, 32609256 - 32609212
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
32609256 |
ccgtgagcttaactcagttggtagggatattgcatattatatgca |
32609212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 209
Target Start/End: Complemental strand, 33041936 - 33041888
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
33041936 |
atccccgtgagtttaactcagttggtagggatattgcatattatatgca |
33041888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 33549127 - 33549075
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||||||||| ||| ||||||| |||||||||||||||| |
|
|
| T |
33549127 |
atccccgtgagcttagctcagttgatagagatattgtatattatatgcaggag |
33549075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 163 - 211
Target Start/End: Original strand, 44658329 - 44658377
Alignment:
| Q |
163 |
ccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| |||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
44658329 |
ccccgtgagcttagctcagttagtaggaatattgcatattatatgcagg |
44658377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 164 - 207
Target Start/End: Complemental strand, 2806571 - 2806528
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
2806571 |
cccgtgagcttagctcagttggtagggatattgtatattatatg |
2806528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 161 - 212
Target Start/End: Complemental strand, 28153215 - 28153164
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagga |
212 |
Q |
| |
|
||||| |||||| || ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28153215 |
atcccagtgagcttaactcagttggtagggatattgcatgttatatgcagga |
28153164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 168 - 211
Target Start/End: Original strand, 31223624 - 31223667
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31223624 |
tgagcttagttcagttggtagggatattgcatattatatgcagg |
31223667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 167 - 209
Target Start/End: Original strand, 5612957 - 5612999
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5612957 |
gtgagcttagctcagttggcagggatattgcatattatatgca |
5612999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 207
Target Start/End: Original strand, 33669733 - 33669779
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
33669733 |
atccccgtgagcttaactcagttagtagggatattgcatattatatg |
33669779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 35798099 - 35798049
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| || |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
35798099 |
atccccgtgagcttaactcagttgttagagatattgcatattatatgcagg |
35798049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 177 - 211
Target Start/End: Original strand, 37063533 - 37063567
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
37063533 |
ctcagttggtagggatattgcatattatatgcagg |
37063567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 177 - 211
Target Start/End: Complemental strand, 37352550 - 37352516
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
37352550 |
ctcagttggtagggatattgcatattatatgcagg |
37352516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 38179318 - 38179268
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38179318 |
atccctgtgagtttagctcagttggtagggatattgcattttatatgcagg |
38179268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 38557296 - 38557246
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| || |||||||||||||||||| |||| ||||||||||| |
|
|
| T |
38557296 |
atccccgtgagcttaactcagttggtagggatatggcattttatatgcagg |
38557246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 207
Target Start/End: Complemental strand, 40363140 - 40363098
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
40363140 |
ccgtgagcttaactcagttggtagggatattgcatattatatg |
40363098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 43936702 - 43936748
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
43936702 |
ccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
43936748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 178 - 211
Target Start/End: Original strand, 38387677 - 38387710
Alignment:
| Q |
178 |
tcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38387677 |
tcagttggtagggatattgcatattatatgcagg |
38387710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 158 - 211
Target Start/End: Complemental strand, 40688715 - 40688662
Alignment:
| Q |
158 |
gacatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| ||||| | ||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
40688715 |
gacatcctcgtgatcttagctcagttggtagagatattgcattttatatgcagg |
40688662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 40864401 - 40864446
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
40864401 |
cgtgagcttagctcagttggtaggaatattgcattttatatgcagg |
40864446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 159 - 211
Target Start/End: Original strand, 22589894 - 22589946
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| || ||||| || || |||||||||||||||||||||||||||||||| |
|
|
| T |
22589894 |
acatcaccatgagcttatcttagttggtagggatattgcatattatatgcagg |
22589946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 159 - 211
Target Start/End: Complemental strand, 24581539 - 24581487
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| ||| || ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
24581539 |
acatccccgtaagcttaactcagttggcagggatattgcataatatatgcagg |
24581487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 207
Target Start/End: Original strand, 32168931 - 32168971
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
32168931 |
gtgagcttaactcagttggtagggatattgcatattatatg |
32168971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 175 - 211
Target Start/End: Original strand, 34355732 - 34355768
Alignment:
| Q |
175 |
agctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34355732 |
agctcagttggtagggatattgtatattatatgcagg |
34355768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 161 - 209
Target Start/End: Original strand, 43895910 - 43895958
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
43895910 |
atccccgtgagcttagctcagttggtagggatatcacattttatatgca |
43895958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 3301811 - 3301858
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||| |||||| |||| |
|
|
| T |
3301811 |
cccgtgagcttagctcatttggtagggatattgcattttatatacagg |
3301858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 159 - 210
Target Start/End: Complemental strand, 5398182 - 5398131
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||| |||| | |||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
5398182 |
acatccctgtgaacttagctcagttggtagggatattacattttatatgcag |
5398131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 207
Target Start/End: Complemental strand, 8742894 - 8742851
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||||| ||||||||||||||| |||||| ||||||||||| |
|
|
| T |
8742894 |
cccgtgagcttagctcagttggtagagatattacatattatatg |
8742851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 9330571 - 9330524
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| || |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
9330571 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
9330524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 213
Target Start/End: Original strand, 17089257 - 17089292
Alignment:
| Q |
178 |
tcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17089257 |
tcagttggtaggaatattgcatattatatgcaggag |
17089292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 210
Target Start/End: Complemental strand, 29942193 - 29942150
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||||| || ||||||| |||||||||||||||||||||||||| |
|
|
| T |
29942193 |
gtgagcttaactcagttagtagggatattgcatattatatgcag |
29942150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 33262438 - 33262489
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
33262438 |
catccccgtgagtttagctcagctggtagggatatcgcattttatatgcagg |
33262489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 161 - 212
Target Start/End: Original strand, 44021071 - 44021122
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagga |
212 |
Q |
| |
|
|||||||||||| || ||||||||||||| ||||||||| |||||| ||||| |
|
|
| T |
44021071 |
atccccgtgagcttaactcagttggtaggaatattgcatgttatatacagga |
44021122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 177 - 212
Target Start/End: Complemental strand, 44898539 - 44898504
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcagga |
212 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44898539 |
ctcagttggtaggaatattgcatattatatgcagga |
44898504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 211
Target Start/End: Complemental strand, 5003693 - 5003659
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5003693 |
ctcagttggtagggatattgcattttatatgcagg |
5003659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 207
Target Start/End: Complemental strand, 7907616 - 7907570
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||| ||| | | |||||||||||||||||||||||||| |
|
|
| T |
7907616 |
atccccgtgagcttagtttaattggtagggatattgcatattatatg |
7907570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 16040238 - 16040288
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||| ||||||| ||| |||||||||||||||||||||| |||| |||||| |
|
|
| T |
16040238 |
atcctcgtgagcttagttcagttggtagggatattgcatgttatttgcagg |
16040288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 168 - 210
Target Start/End: Complemental strand, 16385108 - 16385066
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
16385108 |
tgagcttagctcagttggtatggatattgcattttatatgcag |
16385066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 211
Target Start/End: Original strand, 17601092 - 17601126
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
17601092 |
ctcagttggtagggatattgcatatcatatgcagg |
17601126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 262 - 304
Target Start/End: Original strand, 18544023 - 18544065
Alignment:
| Q |
262 |
aaaaataacctatattacagaaggtaaaacactattaaccctt |
304 |
Q |
| |
|
|||||| |||||||||||||| |||||||||| |||||||||| |
|
|
| T |
18544023 |
aaaaatgacctatattacagagggtaaaacaccattaaccctt |
18544065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 200
Target Start/End: Original strand, 19958097 - 19958135
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcata |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
19958097 |
tccccgtgagcttagctcagttggtagggacattgcata |
19958135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 200
Target Start/End: Original strand, 20919608 - 20919646
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcata |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
20919608 |
tccccgtgagcttagctcagttggtagggacattgcata |
20919646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 27016278 - 27016324
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| ||| |||||||||| |||||||||||||||||| |||| |
|
|
| T |
27016278 |
ccgtgagcttagttcagttggtatggatattgcatattatatacagg |
27016324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 29449445 - 29449495
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
29449445 |
atccccatgagcttagctcagttggtagggatatcacattttatatgcagg |
29449495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 207
Target Start/End: Complemental strand, 29772347 - 29772305
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||| || | ||||||||||||||||||||||||||||| |
|
|
| T |
29772347 |
ccgtgagcttaacacagttggtagggatattgcatattatatg |
29772305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 207
Target Start/End: Complemental strand, 33222211 - 33222181
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
33222211 |
ctcagttggtagggatattgcatattatatg |
33222181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 33563282 - 33563232
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| | || |||||||||||||||||||| || ||||||||||| |
|
|
| T |
33563282 |
atccccgtgaacttaactcagttggtagggatattgtattttatatgcagg |
33563232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 211
Target Start/End: Complemental strand, 33816473 - 33816439
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
33816473 |
ctcagttggtagagatattgcatattatatgcagg |
33816439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 263 - 305
Target Start/End: Original strand, 36525610 - 36525652
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaacccttt |
305 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36525610 |
aaaatgacctatattacagggggtaaaacactattaacccttt |
36525652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 40473623 - 40473573
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| || |||||||||||| ||||||||| ||||||||||| |
|
|
| T |
40473623 |
atccccgtgagcttaactcagttggtagaaatattgcatgttatatgcagg |
40473573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 207
Target Start/End: Original strand, 41286132 - 41286174
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||| | | |||||||||||||||||||||||||||||| |
|
|
| T |
41286132 |
ccgtgagcttggttcagttggtagggatattgcatattatatg |
41286174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 43146349 - 43146399
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||| | |||||||| |
|
|
| T |
43146349 |
atccccgtgagtttaactcagttggtagggatattgcataatttatgcagg |
43146399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 200
Target Start/End: Original strand, 43214354 - 43214392
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcata |
200 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
43214354 |
tccccgtgagcttaactcagttggtagggatattgcata |
43214392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 161 - 206
Target Start/End: Original strand, 8763379 - 8763424
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
|||||||||||| ||||||| || ||||||||||||||| |||||| |
|
|
| T |
8763379 |
atccccgtgagcttagctcaattcgtagggatattgcattttatat |
8763424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 11093858 - 11093809
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| || |||| || |||||||||| |||||||||||||||||| |
|
|
| T |
11093858 |
cccgtgagcttaactcatttagtagggatatcgcatattatatgcaggag |
11093809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Complemental strand, 11115300 - 11115259
Alignment:
| Q |
262 |
aaaaataacctatattacagaaggtaaaacactattaaccct |
303 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
11115300 |
aaaaataacctatattacagggggtaaaacaccattaaccct |
11115259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 211
Target Start/End: Complemental strand, 13606311 - 13606266
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13606311 |
cgtgagcttagctcagttggtagggatattaagtattatatgcagg |
13606266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 17886469 - 17886428
Alignment:
| Q |
263 |
aaaataacctatattacagaa-ggtaaaacactattaaccct |
303 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
17886469 |
aaaataacctatattacaggatggtaaaacactattaaccct |
17886428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 211
Target Start/End: Complemental strand, 35429674 - 35429625
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| ||||||||||||||| || |||||||| | |||||||| |
|
|
| T |
35429674 |
tccccgtgagcttagctcagttggtagagacattgcataatttatgcagg |
35429625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 264 - 305
Target Start/End: Complemental strand, 38127801 - 38127760
Alignment:
| Q |
264 |
aaataacctatattacagaaggtaaaacactattaacccttt |
305 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38127801 |
aaatgacctatattacagggggtaaaacactattaacccttt |
38127760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 211
Target Start/End: Original strand, 39265688 - 39265725
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
39265688 |
tagctcagttggtagcgatactgcatattatatgcagg |
39265725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 177 - 206
Target Start/End: Complemental strand, 42199938 - 42199909
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42199938 |
ctcagttggtagggatattgcatattatat |
42199909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 162 - 209
Target Start/End: Original strand, 20435775 - 20435823
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggta-gggatattgcatattatatgca |
209 |
Q |
| |
|
||||||||||| ||||||| |||||| ||||||||||||||| |||||| |
|
|
| T |
20435775 |
tccccgtgagcttagctcacttggtaagggatattgcatattttatgca |
20435823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 167 - 207
Target Start/End: Complemental strand, 23919544 - 23919504
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||| |||||| |
|
|
| T |
23919544 |
gtgagcttagctcagttggtagggacattgcataatatatg |
23919504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 165 - 209
Target Start/End: Original strand, 25932537 - 25932581
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||| | ||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
25932537 |
ccgtgaacttagctcagttggtagggatattgtatattaaatgca |
25932581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 185 - 213
Target Start/End: Complemental strand, 27463751 - 27463723
Alignment:
| Q |
185 |
gtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27463751 |
gtagggatattgcatattatatgcaggag |
27463723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 174 - 210
Target Start/End: Complemental strand, 27464191 - 27464155
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
27464191 |
tagctcagttggtaggaatattgcatgttatatgcag |
27464155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 264 - 300
Target Start/End: Original strand, 29884253 - 29884289
Alignment:
| Q |
264 |
aaataacctatattacagaaggtaaaacactattaac |
300 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
29884253 |
aaatgacctatattacaggaggtaaaacactattaac |
29884289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 263 - 303
Target Start/End: Original strand, 33315443 - 33315483
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaaccct |
303 |
Q |
| |
|
||||| |||||||||||||| ||||||| |||||||||||| |
|
|
| T |
33315443 |
aaaatgacctatattacagagggtaaaatactattaaccct |
33315483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 174 - 218
Target Start/End: Complemental strand, 36143253 - 36143209
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcaggaggcgga |
218 |
Q |
| |
|
||||||||||||| |||||||||||||||||| | ||||| |||| |
|
|
| T |
36143253 |
tagctcagttggtcgggatattgcatattatacgtaggagtcgga |
36143209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 152)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 149 - 213
Target Start/End: Complemental strand, 1570277 - 1570213
Alignment:
| Q |
149 |
attgtttttgacatccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||| |||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1570277 |
attgttgttgatatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
1570213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 6130106 - 6130054
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6130106 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
6130054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 161 - 217
Target Start/End: Complemental strand, 26584819 - 26584763
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgg |
217 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26584819 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcgg |
26584763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 160 - 218
Target Start/End: Complemental strand, 4482672 - 4482614
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgga |
218 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4482672 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgga |
4482614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 159 - 213
Target Start/End: Complemental strand, 15819676 - 15819622
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15819676 |
acatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
15819622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 160 - 213
Target Start/End: Original strand, 6702572 - 6702625
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6702572 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
6702625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 156 - 213
Target Start/End: Complemental strand, 12502332 - 12502275
Alignment:
| Q |
156 |
ttgacatccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12502332 |
ttgacatccccgtaagcatagctcagttggtagggatattgcatattatatgcaggag |
12502275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 159 - 211
Target Start/End: Original strand, 3269614 - 3269666
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3269614 |
acatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
3269666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 6438137 - 6438085
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6438137 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
6438085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 159 - 211
Target Start/End: Original strand, 8865849 - 8865901
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8865849 |
acatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
8865901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 25999847 - 25999899
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25999847 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
25999899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 32594248 - 32594300
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32594248 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
32594300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 33254725 - 33254777
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33254725 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
33254777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 33274897 - 33274949
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33274897 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
33274949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 40375388 - 40375336
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40375388 |
atccccgtgagcatagctcagttggtagggatattgcatattatatgcaggag |
40375336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 40519617 - 40519565
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40519617 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
40519565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 46965737 - 46965789
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46965737 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
46965789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 50899583 - 50899531
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50899583 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
50899531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 7166300 - 7166250
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7166300 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
7166250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 163 - 213
Target Start/End: Original strand, 16343027 - 16343077
Alignment:
| Q |
163 |
ccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16343027 |
ccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
16343077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 18467271 - 18467221
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18467271 |
atccccgtgagcatagctcagttggtagggatattgcatattatatgcagg |
18467221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 21265653 - 21265703
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21265653 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
21265703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 22563383 - 22563433
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22563383 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
22563433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 33207202 - 33207252
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33207202 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
33207252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 35605696 - 35605646
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35605696 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
35605646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 42490483 - 42490433
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42490483 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
42490433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 161 - 210
Target Start/End: Complemental strand, 10664867 - 10664818
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10664867 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcag |
10664818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 1151756 - 1151808
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1151756 |
atccccgtgagcttagctcagttggtagggatattgcatattatatacaggag |
1151808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 2277755 - 2277803
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2277755 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
2277803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 13773165 - 13773217
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13773165 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcaggag |
13773217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 16526250 - 16526198
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16526250 |
atccccgtgagcttagctcaattggtagggatattgcatattatatgcaggag |
16526198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 159 - 211
Target Start/End: Complemental strand, 18551708 - 18551656
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18551708 |
acatccccgtgagcttagctcagttggtatggatattgcatattatatgcagg |
18551656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 34058215 - 34058263
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34058215 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
34058263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 43884791 - 43884843
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43884791 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcaggag |
43884843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 46021952 - 46021900
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46021952 |
atccccgtgagcgtagctcagtaagtagggatattgcatattatatgcaggag |
46021900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 9866254 - 9866207
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9866254 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
9866207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 1836500 - 1836550
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1836500 |
atccccgtgagcttagctcagttggtagggatattacatattatatgcagg |
1836550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 2556553 - 2556603
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2556553 |
atccccgtaagcttagctcagttggtagggatattgcatattatatgcagg |
2556603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 6893310 - 6893260
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6893310 |
atccccgtgagcttagctcagttggtagggatattgcattttatatgcagg |
6893260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 11215002 - 11215048
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11215002 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
11215048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 37662630 - 37662580
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37662630 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatgcagg |
37662580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 207
Target Start/End: Original strand, 42054330 - 42054376
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42054330 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
42054376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 47402736 - 47402686
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47402736 |
atccccgtgagcttagctcagctggtagggatattgcatattatatgcagg |
47402686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 48638529 - 48638579
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48638529 |
atccccgtgagcttagctcagttggtagggatattgcattttatatgcagg |
48638579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 51050187 - 51050237
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
51050187 |
atccccgtgagcttagctcagttggtagggatattgtatattatatgcagg |
51050237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 174 - 218
Target Start/End: Complemental strand, 923164 - 923120
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcaggaggcgga |
218 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
923164 |
tagcgcagttggtagggatattgcatattatatgcaggaggcgga |
923120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 2352638 - 2352586
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
2352638 |
atccccgtgagcttagctcagttgatagagatattgcatattatatgcaggag |
2352586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 155 - 211
Target Start/End: Original strand, 8415720 - 8415776
Alignment:
| Q |
155 |
tttgacatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||| ||||| ||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8415720 |
tttgtcatccacgtgagcttagctcagttcgtagggatattgcatattatatgcagg |
8415776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 23545527 - 23545475
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
23545527 |
atccccgtgagctaagcttagttggtagggatattgcatattatatgcaggag |
23545475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 26550491 - 26550543
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26550491 |
atccccgtgagcttaactcagttggtagggatattgcatactatatgcaggag |
26550543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 29188633 - 29188685
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29188633 |
atccccgtgattttagctcagttggtagggatattgcatattatatgcaggag |
29188685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 209
Target Start/End: Original strand, 40520827 - 40520875
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40520827 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgca |
40520875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 209
Target Start/End: Original strand, 44732630 - 44732678
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
44732630 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgca |
44732678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 161 - 208
Target Start/End: Original strand, 2754357 - 2754404
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgc |
208 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2754357 |
atccccgtgagcttagcttagttggtagggatattgcatattatatgc |
2754404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 174 - 213
Target Start/End: Original strand, 52369607 - 52369646
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52369607 |
tagctcagttggtagggatattgcatattatatgcaggag |
52369646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 211
Target Start/End: Complemental strand, 52426987 - 52426936
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||| |||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52426987 |
catctccgtgagcttagctcagttgatagggatattgcatattatatgcagg |
52426936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 7180687 - 7180637
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7180687 |
atccccgtgaggttagctcagttggtaggaatattgcatattatatgcagg |
7180637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 164 - 218
Target Start/End: Original strand, 15775739 - 15775793
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgga |
218 |
Q |
| |
|
||||||||| || |||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15775739 |
cccgtgagcttaactcaattggtagggatattgcatattatatgcaggagccgga |
15775793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 19011356 - 19011402
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19011356 |
ccgtgagcttagctcaattggtagggatattgcatattatatgcagg |
19011402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 164 - 210
Target Start/End: Complemental strand, 32556999 - 32556953
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32556999 |
cccgtgagcttagctcagctggtagggatattgcatattatatgcag |
32556953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 14760822 - 14760772
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14760822 |
atccccgtgagcttagctcagttggtag--atattgcatattatatgcaggag |
14760772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 211
Target Start/End: Complemental strand, 32970872 - 32970823
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
32970872 |
tccccgtaagcgtagctcagttgatagggatattgcattttatatgcagg |
32970823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 166 - 211
Target Start/End: Complemental strand, 42299581 - 42299536
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42299581 |
cgtgagcttagttcagttggtagggatattgcatattatatgcagg |
42299536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 46161189 - 46161144
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46161189 |
tgagcttagctcagttggtaggaatattgcatattatatgcaggag |
46161144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 47930731 - 47930694
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47930731 |
tagctcagttggtagggatattgcatattatatgcagg |
47930694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 159 - 211
Target Start/End: Complemental strand, 4553621 - 4553569
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||| || |||||||||||| ||||||||||||||||||||| |
|
|
| T |
4553621 |
acatccccgtgagcttaactcagttggtagaaatattgcatattatatgcagg |
4553569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 8984574 - 8984526
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||| || ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8984574 |
ccgtgagcttaactcagttggcagggatattgcatattatatgcaggag |
8984526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 209
Target Start/End: Original strand, 18216903 - 18216951
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||| |||||| |
|
|
| T |
18216903 |
atccccgtgagcttagctcagttggtagggatattacatattttatgca |
18216951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 18534002 - 18534050
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
18534002 |
ccgtgagcttagctcagttggtagagatattgcatattatatgtaggag |
18534050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 34580859 - 34580807
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34580859 |
atccccgtgagttcagctcagttggtagggatattgtatattatatgcaggag |
34580807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 46225390 - 46225434
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46225390 |
gtgagcttagctcagttggtagggatattgcattttatatgcagg |
46225434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 168 - 212
Target Start/End: Original strand, 51933510 - 51933554
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcagga |
212 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
51933510 |
tgagcttagctcaattggtagggatattgcatattatatgcagga |
51933554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 11065116 - 11065167
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| |||||||| || ||| |||||||||||||||||||||| |
|
|
| T |
11065116 |
catccccgtgagcttagctcagatgatagagatattgcatattatatgcagg |
11065167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 15390220 - 15390267
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15390220 |
cccgtgagcttaactcagttggtagggatattgcatattagatgcagg |
15390267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 206
Target Start/End: Original strand, 27818568 - 27818611
Alignment:
| Q |
163 |
ccccgtgagcgtagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27818568 |
ccccctgagcttagctcagttggtagggatattgcatattatat |
27818611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 34271840 - 34271891
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
34271840 |
catccccgtgagtttagctcagctggtagggatattacatattatatgcagg |
34271891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 161 - 212
Target Start/End: Complemental strand, 43668030 - 43667979
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagga |
212 |
Q |
| |
|
|||||||| ||| |||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
43668030 |
atccccgtaagcttagctcagttcgtagagatattgcatattatatgcagga |
43667979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 47478922 - 47478875
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||| ||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
47478922 |
catcctcgtgagcttaactcagttggtagggatattgcatattatatg |
47478875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 213
Target Start/End: Complemental strand, 50824466 - 50824431
Alignment:
| Q |
178 |
tcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
50824466 |
tcagttggtagggatattgcatattatatgcaggag |
50824431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 3694982 - 3694936
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
3694982 |
gtgagcttagctcagttggaagggatattgcatattatatgtaggag |
3694936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 5190854 - 5190804
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
5190854 |
atccccatgagcttagctcaattggtagggatatcgcatattatatgcagg |
5190804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 6463109 - 6463059
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
6463109 |
atccccatgagcttagctcagttggtagggatattgtattttatatgcagg |
6463059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 7191033 - 7191079
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7191033 |
ccgtgaccttagctcagttgatagggatattgcatattatatgcagg |
7191079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 12404353 - 12404403
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| ||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
12404353 |
atccccgtgagattagatcaattggtagggatattgcatattatatgcagg |
12404403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 13538519 - 13538469
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| |||| | ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13538519 |
atcccagtgaacttagttcagttggtagggatattgcatattatatgcagg |
13538469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 17671483 - 17671433
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||| | ||||||||| |
|
|
| T |
17671483 |
atccccgtgagcttagctcagttggtagggatatcgcatttcatatgcagg |
17671433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 27650694 - 27650744
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||| ||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
27650694 |
atcctcgtgagctaagttcagttggtagggatattgcatattatatgcagg |
27650744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 33033127 - 33033173
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
33033127 |
ccgtgagcttaattcagttggtagggatattgcatattatatgcagg |
33033173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 36314052 - 36314002
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| | ||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36314052 |
atccccattagcatagctcagttggtagggatattgcatattatttgcagg |
36314002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 177 - 211
Target Start/End: Original strand, 40634214 - 40634248
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
40634214 |
ctcagttggtagggatattgcatattatatgcagg |
40634248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 168 - 210
Target Start/End: Complemental strand, 42848797 - 42848755
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42848797 |
tgagcttagctcagttgatagggatattgcatattatatgcag |
42848755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 45271763 - 45271813
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| | | ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45271763 |
atccccgttaacttagttcagttggtagggatattgcatattatatgcagg |
45271813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 45333784 - 45333735
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
45333784 |
atccccgtgagcttagctcagttggcagggatattgcata-tatatgcagg |
45333735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 48897190 - 48897140
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| || |||| |||||||| ||||||||||||||||||||| |
|
|
| T |
48897190 |
atccccgtgagcttaactcatttggtaggaatattgcatattatatgcagg |
48897140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 166 - 211
Target Start/End: Complemental strand, 6712177 - 6712132
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
6712177 |
cgtgagcttagctcagttggtaggtatattgcattttatatgcagg |
6712132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 174 - 211
Target Start/End: Original strand, 24253782 - 24253819
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24253782 |
tagctcatttggtagggatattgcatattatatgcagg |
24253819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 164 - 209
Target Start/End: Original strand, 24874971 - 24875016
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| | |||||| |
|
|
| T |
24874971 |
cccgtgagcttagctcagttggtagggatattgcataatttatgca |
24875016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 27642786 - 27642749
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27642786 |
tagctcagttggtagggatattgcattttatatgcagg |
27642749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 162 - 210
Target Start/End: Complemental strand, 12650456 - 12650408
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||||| | |||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
12650456 |
tccccgtgaacttagctcagttggtaaggatattgcatgttatatgcag |
12650408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 209
Target Start/End: Original strand, 15595726 - 15595770
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||| |||||||| |
|
|
| T |
15595726 |
ccgtgagcttagctcagttggtagggacattgcataatatatgca |
15595770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 209
Target Start/End: Original strand, 16182199 - 16182243
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||| ||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
16182199 |
ccgtgagcttagctgagttggtagagatattgcatattatatgca |
16182243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 218
Target Start/End: Complemental strand, 16313774 - 16313722
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgga |
218 |
Q |
| |
|
||||||| || |||| |||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
16313774 |
cgtgagcttaactcaattggtaggaatattgcatattatatgcaggagccgga |
16313722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 174 - 210
Target Start/End: Original strand, 17580327 - 17580363
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17580327 |
tagctcagttggtagggatattgcatgttatatgcag |
17580363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 25580689 - 25580737
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||| || |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
25580689 |
ccgtgagcttaactcagttggtagagatattgcatattatatgccggag |
25580737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 211
Target Start/End: Complemental strand, 36666647 - 36666599
Alignment:
| Q |
163 |
ccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||| | |||||||| |
|
|
| T |
36666647 |
ccccgtgagcttagctcagttggtagggacattgcataatttatgcagg |
36666599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 209
Target Start/End: Original strand, 44019277 - 44019321
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
44019277 |
ccgtgagcttagctcagttgatagggatattgcattttatatgca |
44019321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 262 - 305
Target Start/End: Original strand, 46584077 - 46584121
Alignment:
| Q |
262 |
aaaaataacctatattaca-gaaggtaaaacactattaacccttt |
305 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46584077 |
aaaaatgacctatattacaagaaggtaaaacactattaacccttt |
46584121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 211
Target Start/End: Original strand, 49253609 - 49253656
Alignment:
| Q |
163 |
ccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| ||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
49253609 |
ccccgtgagcttagctaagttggtagg-atattgcatattatatgcagg |
49253656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 207
Target Start/End: Original strand, 25034904 - 25034947
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||| ||||||| |
|
|
| T |
25034904 |
cccgtgagcttagctcagttggtaggaatattgcattttatatg |
25034947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 262 - 305
Target Start/End: Original strand, 26399534 - 26399577
Alignment:
| Q |
262 |
aaaaataacctatattacagaaggtaaaacactattaacccttt |
305 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||| ||||||||||| |
|
|
| T |
26399534 |
aaaaataacctatattacaggaggtaaagcaccattaacccttt |
26399577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 161 - 212
Target Start/End: Original strand, 38032201 - 38032252
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagga |
212 |
Q |
| |
|
|||||||||| | ||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
38032201 |
atccccgtgaacttagatcagctggtagggatattgcatattgtatgcagga |
38032252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 211
Target Start/End: Complemental strand, 41709997 - 41709946
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||| |||||||| ||||| |||||||||||||||||| | ||||||||||| |
|
|
| T |
41709997 |
catctccgtgagcttagcttagttggtagggatattgcgtgttatatgcagg |
41709946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 42550079 - 42550032
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| ||||||| | |||||||||||||||||||| ||||||| |
|
|
| T |
42550079 |
cccgtgagcttagctcaatcggtagggatattgcatattacatgcagg |
42550032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 211
Target Start/End: Complemental strand, 45517342 - 45517291
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||| |||||||| ||| |||||||||||||||||||||| |||||| |||| |
|
|
| T |
45517342 |
catctccgtgagcttagttcagttggtagggatattgcattttatatacagg |
45517291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 3768034 - 3767996
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcata-ttatatgcagg |
211 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3768034 |
tagctcagttggtagggatattgcatatttatatgcagg |
3767996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 211
Target Start/End: Original strand, 8780781 - 8780815
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8780781 |
ctcagttggtacggatattgcatattatatgcagg |
8780815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 10851821 - 10851871
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||| ||||||| ||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
10851821 |
atcctcgtgagcttagctcaattggtaaggatattgtatattatatgcagg |
10851871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 263 - 305
Target Start/End: Complemental strand, 14909800 - 14909758
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaacccttt |
305 |
Q |
| |
|
||||| |||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
14909800 |
aaaattacctatattacagagggtaaagcactattaacccttt |
14909758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 17776837 - 17776887
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| |||| |||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
17776837 |
atccccatgagtttagctcagttggtaggcatattgcattttatatgcagg |
17776887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 207
Target Start/End: Original strand, 27344476 - 27344522
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||| ||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
27344476 |
atcctcgtgagcttagctcagttggtagacatattgcatattatatg |
27344522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 207
Target Start/End: Original strand, 28867480 - 28867522
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||| | |||||||||||||||| ||||||||||||||||| |
|
|
| T |
28867480 |
ccgtgaacttagctcagttggtaggaatattgcatattatatg |
28867522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 37626230 - 37626180
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||| || ||||||||||| |
|
|
| T |
37626230 |
atccccgtgagcttacctcagttggtagggatattatattttatatgcagg |
37626180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 211
Target Start/End: Original strand, 51942308 - 51942342
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
51942308 |
ctcagttggtagggatattgcatattatatacagg |
51942342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 211
Target Start/End: Complemental strand, 3560449 - 3560404
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| || ||||||||||||||||||| |||||||||||||| |
|
|
| T |
3560449 |
cgtgagcttaactcagttggtagggatattatatattatatgcagg |
3560404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 211
Target Start/End: Original strand, 6213431 - 6213468
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
6213431 |
tagctcaattggtagggatattgcatattatatacagg |
6213468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 207
Target Start/End: Original strand, 14349654 - 14349687
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
14349654 |
tagctcagttggtagagatattgcatattatatg |
14349687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 19063393 - 19063356
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
19063393 |
tagctcagttagtagagatattgcatattatatgcagg |
19063356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 20030080 - 20030125
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| || ||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
20030080 |
cgtgagcttatctcagttggtaggaatattgcattttatatgcagg |
20030125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 263 - 304
Target Start/End: Original strand, 26399192 - 26399233
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaaccctt |
304 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26399192 |
aaaatgacctatattacagggggtaaaacactattaaccctt |
26399233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 176 - 213
Target Start/End: Original strand, 29527126 - 29527163
Alignment:
| Q |
176 |
gctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
29527126 |
gctcagttggtatggatattgtatattatatgcaggag |
29527163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 31401315 - 31401266
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| ||||||||||| |||||| |||||||| | |||||||||| |
|
|
| T |
31401315 |
cccgtgagcttagctcagttgatagggacattgcataatttatgcaggag |
31401266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 161 - 206
Target Start/End: Complemental strand, 31762069 - 31762024
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
||||| |||||| |||||||||||| || ||||||||||||||||| |
|
|
| T |
31762069 |
atcccagtgagcttagctcagttggcagtgatattgcatattatat |
31762024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 31818598 - 31818643
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||| ||| ||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
31818598 |
tgagcttagttcagttgctaggaatattgcatattatatgcaggag |
31818643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 36726561 - 36726610
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||| ||||||||||| |||| |||||| |||||||||||||||| |
|
|
| T |
36726561 |
cccgtgagtttagctcagttgataggaatattgtatattatatgcaggag |
36726610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 211
Target Start/End: Complemental strand, 37403193 - 37403148
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| | |||||||| |||||||||||||||| |||||||||| |
|
|
| T |
37403193 |
cgtgagcttggctcagttagtagggatattgcataatatatgcagg |
37403148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 211
Target Start/End: Complemental strand, 47469145 - 47469096
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| |||||||||||| ||||| |||||||| | |||||||| |
|
|
| T |
47469145 |
tccccgtgagcttagctcagttggcagggacattgcataatttatgcagg |
47469096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 177 - 210
Target Start/End: Complemental strand, 49425035 - 49425002
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
49425035 |
ctcaattggtagggatattgcatattatatgcag |
49425002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 30468 - 30416
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||| | || |||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
30468 |
atccccgtgaacttaattcagttagtagggatattgcattttatatgcaggag |
30416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 262 - 302
Target Start/End: Complemental strand, 12277228 - 12277188
Alignment:
| Q |
262 |
aaaaataacctatattacagaaggtaaaacactattaaccc |
302 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||| |||||||| |
|
|
| T |
12277228 |
aaaaatgacctatattacaggaggtaaaacaccattaaccc |
12277188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 209
Target Start/End: Original strand, 19924428 - 19924476
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||| | || |||||||||||||||||| |||| ||||||||| |
|
|
| T |
19924428 |
atccccgtgatcttaactcagttggtagggatatcgcattttatatgca |
19924476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 160 - 196
Target Start/End: Complemental strand, 23933142 - 23933106
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattg |
196 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
23933142 |
catccccgtgagcttagctcagttggtagggacattg |
23933106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 262 - 306
Target Start/End: Original strand, 24963020 - 24963064
Alignment:
| Q |
262 |
aaaaataacctatattacagaaggtaaaacactattaaccctttc |
306 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
24963020 |
aaaaataacctatattacagggggtaaaagcctattaaccctttc |
24963064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 163 - 211
Target Start/End: Complemental strand, 27579545 - 27579497
Alignment:
| Q |
163 |
ccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| | || ||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
27579545 |
ccccgtgaacttaactcagttggtatggatattacatattatatgcagg |
27579497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 32977637 - 32977689
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||| ||||| | |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32977637 |
atccacgtgaacttagctcagttggtataaatattgcatattatatgcaggag |
32977689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 262 - 302
Target Start/End: Original strand, 34945878 - 34945918
Alignment:
| Q |
262 |
aaaaataacctatattacagaaggtaaaacactattaaccc |
302 |
Q |
| |
|
|||||| |||||||||||||| |||||||||| |||||||| |
|
|
| T |
34945878 |
aaaaatgacctatattacagagggtaaaacaccattaaccc |
34945918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 35121116 - 35121072
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| ||||| ||||||||| |||||||||||||| ||||||| |
|
|
| T |
35121116 |
gtgagcttagcttagttggtagcgatattgcatattacatgcagg |
35121072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 39347051 - 39347000
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||| |||||||| | ||||||||| ||||||||||||| |
|
|
| T |
39347051 |
atccccgtgagcttagcttagttggta-gtatattgcattttatatgcaggag |
39347000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 263 - 303
Target Start/End: Original strand, 41190167 - 41190207
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaaccct |
303 |
Q |
| |
|
|||||||| ||||||||||| ||||||| |||||||||||| |
|
|
| T |
41190167 |
aaaataacatatattacagagggtaaaatactattaaccct |
41190207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 159 - 211
Target Start/End: Original strand, 42469410 - 42469462
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| | ||||||||||||| ||||||| ||||||||| |||| |
|
|
| T |
42469410 |
acatccccgtgagtttcgctcagttggtagagatattgtatattatatacagg |
42469462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 174 - 206
Target Start/End: Complemental strand, 47643044 - 47643012
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
47643044 |
tagctcagttggtagggatattgcattttatat |
47643012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 262 - 302
Target Start/End: Complemental strand, 51809796 - 51809756
Alignment:
| Q |
262 |
aaaaataacctatattacagaaggtaaaacactattaaccc |
302 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
51809796 |
aaaaataacctatattacagggggtaaaacaccattaaccc |
51809756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 52773322 - 52773374
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||| |||||| ||||||| ||||| || ||||||||||||||||| ||||| |
|
|
| T |
52773322 |
atcccggtgagcttagctcacttggtgggaatattgcatattatatgtaggag |
52773374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 52; Significance: 9e-21; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 158 - 213
Target Start/End: Complemental strand, 4090 - 4035
Alignment:
| Q |
158 |
gacatccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4090 |
gacatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
4035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 160 - 218
Target Start/End: Original strand, 8962 - 9020
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgga |
218 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8962 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgga |
9020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 173)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 160 - 213
Target Start/End: Complemental strand, 55251425 - 55251372
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55251425 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
55251372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 3847678 - 3847730
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3847678 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
3847730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 6371111 - 6371163
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6371111 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
6371163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 26868346 - 26868398
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26868346 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
26868398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 26919541 - 26919489
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26919541 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
26919489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 43147457 - 43147405
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43147457 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
43147405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 43207666 - 43207718
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43207666 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
43207718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 43596892 - 43596944
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43596892 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
43596944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 46105532 - 46105584
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46105532 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
46105584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 46775103 - 46775051
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46775103 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
46775051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 27743778 - 27743731
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27743778 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
27743731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 8965091 - 8965141
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8965091 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
8965141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 159 - 213
Target Start/End: Complemental strand, 23705228 - 23705174
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23705228 |
acatccccgtgagcttagctcagttggtagggatattgcatattacatgcaggag |
23705174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 24680159 - 24680109
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24680159 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
24680109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 37935858 - 37935908
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37935858 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
37935908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 39023172 - 39023222
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39023172 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
39023222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 48569249 - 48569199
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48569249 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
48569199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 49901479 - 49901529
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49901479 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
49901529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 158 - 211
Target Start/End: Complemental strand, 3764084 - 3764031
Alignment:
| Q |
158 |
gacatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3764084 |
gacatccccgtgagcttagctcagttggtagggatattacatattatatgcagg |
3764031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 22230504 - 22230455
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22230504 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
22230455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 160 - 213
Target Start/End: Complemental strand, 45112185 - 45112132
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45112185 |
catccccgtgagcttacctcagttggtagggatattgcatattatatgcaggag |
45112132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 160 - 213
Target Start/End: Complemental strand, 49757358 - 49757305
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49757358 |
catccccgtgagcatagctcagttggtaggaatattgcatattatatgcaggag |
49757305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 4234358 - 4234306
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4234358 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgcaggag |
4234306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 4958629 - 4958577
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4958629 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgcaggag |
4958577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 8433696 - 8433644
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8433696 |
atccccgtgagcttagctcagttggtagggatattgcatattatatccaggag |
8433644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 9761112 - 9761164
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9761112 |
atccccgtgagcttacctcagttggtagggatattgcatattatatgcaggag |
9761164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 159 - 211
Target Start/End: Complemental strand, 25235872 - 25235820
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25235872 |
acatccccgtgagcttagcttagttggtagggatattgcatattatatgcagg |
25235820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 45126129 - 45126181
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45126129 |
atccccgtgagcttagctcagttggtagggatattgtatattatatgcaggag |
45126181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 55536377 - 55536429
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
55536377 |
atccccgtgagcttagctcagttggtaaggatattgcatattatatgcaggag |
55536429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 22788744 - 22788697
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22788744 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
22788697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 40051618 - 40051665
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40051618 |
catccccgtgagcttagctcagttggtagggatattgcatattatatg |
40051665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 43978008 - 43978055
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43978008 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
43978055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 44602481 - 44602532
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44602481 |
catccccgtgagcttagctcagttggtagggatattgcattttatatgcagg |
44602532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 211
Target Start/End: Complemental strand, 47934146 - 47934095
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47934146 |
catccccgtgagcttagctcagttggtagggatatggcatattatatgcagg |
47934095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 3036128 - 3036078
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3036128 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
3036078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 159 - 213
Target Start/End: Complemental strand, 10417296 - 10417242
Alignment:
| Q |
159 |
acatccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10417296 |
acatccccatgagcttagctcagttggtagggatattacatattatatgcaggag |
10417242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 11375962 - 11375912
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11375962 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgcagg |
11375912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 219
Target Start/End: Complemental strand, 23787412 - 23787354
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcggaa |
219 |
Q |
| |
|
||||| |||||| || ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23787412 |
atccctgtgagcataactcagttggtagggatattgcatattatatgcaggagccggaa |
23787354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 30217600 - 30217646
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30217600 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
30217646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 45849044 - 45849094
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45849044 |
atccccgtgagcttagctcagttggtagggatattgcatattttatgcagg |
45849094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 55238572 - 55238522
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
55238572 |
atccccgtgagcttagcttagttggtagggatattgcatattatatgcagg |
55238522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 55853181 - 55853131
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
55853181 |
atccccgtgagcttagctcagttggtagagatattgcatattatatgcagg |
55853131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 160 - 213
Target Start/End: Complemental strand, 1458092 - 1458039
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| ||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1458092 |
catccccgtaagcttagctcagttgatagggatattgcatattatatgcaggag |
1458039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 3815060 - 3815109
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3815060 |
cccgtgagcttagcttagttggtagggatattgcatattatatgcaggag |
3815109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 210
Target Start/End: Original strand, 34353780 - 34353825
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34353780 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcag |
34353825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 40994173 - 40994124
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40994173 |
cccgtgagcttagctcagttggtagggatattgcatattatatgtaggag |
40994124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 161 - 210
Target Start/End: Original strand, 52798275 - 52798324
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
52798275 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcag |
52798324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 637096 - 637148
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
637096 |
atccccgtgagcttagctcagctggtaggaatattgcatattatatgcaggag |
637148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 12504716 - 12504664
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||| ||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12504716 |
atcctcgtgagcttatctcagttggtagggatattgcatattatatgcaggag |
12504664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 35219573 - 35219522
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35219573 |
atccccgtgagcttagctcagttggtagggatattgcatatta-atgcaggag |
35219522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 46582631 - 46582683
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46582631 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggag |
46582683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 213
Target Start/End: Original strand, 37251111 - 37251162
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37251111 |
tccccgtgagcttaactcagttggtagggatattgcatattttatgcaggag |
37251162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 39696405 - 39696358
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39696405 |
cgtgagcttagctcagttggtagggatattgcatattatatgtaggag |
39696358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 39697932 - 39697885
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39697932 |
cccgtgagcttagctcagttgatagggatattgcatattatatgcagg |
39697885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 45673648 - 45673699
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| || ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45673648 |
catccccgtgagcttaactcagttggtaggaatattgcatattatatgcagg |
45673699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 158 - 213
Target Start/End: Original strand, 49447115 - 49447170
Alignment:
| Q |
158 |
gacatccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| ||||| |||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
49447115 |
gacatccccatgagcttagctcagttggtaaggatattgcatattatatgtaggag |
49447170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 50457784 - 50457737
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50457784 |
cccgtgagcttagctcagttggtaaggatattgcatattatatgcagg |
50457737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 161 - 208
Target Start/End: Complemental strand, 51512082 - 51512035
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgc |
208 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51512082 |
atccccgtgagctgagctcagttggtagggatattgcatattatatgc |
51512035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 3157290 - 3157240
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3157290 |
atccccgtgaacttagctcagttggtaggaatattgcatattatatgcagg |
3157240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 4590243 - 4590293
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4590243 |
atccccgtgagtttagctcagttggtagggatattgcatattatatacagg |
4590293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 5165854 - 5165904
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| || |||||||||||||||||| |||||||||||||||| |
|
|
| T |
5165854 |
atccccgtgagcttaactcagttggtagggatatcgcatattatatgcagg |
5165904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 7686335 - 7686285
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
7686335 |
atccccgtgagcttagctcagttggtagagatattgcattttatatgcagg |
7686285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 10402438 - 10402488
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| || |||||||||||| |||||||||||||||||||||| |
|
|
| T |
10402438 |
atccccgtgagcttaactcagttggtagagatattgcatattatatgcagg |
10402488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 177 - 215
Target Start/End: Complemental strand, 12167673 - 12167635
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcaggaggc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12167673 |
ctcagttggtagggatattgcatattatatgcaggaggc |
12167635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 13578534 - 13578488
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13578534 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
13578488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 21935474 - 21935524
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21935474 |
atccccgcaagcttagctcagttggtagggatattgcatattatatgcagg |
21935524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 35465432 - 35465482
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
35465432 |
atccccgtgagcttagctcagttggtagggatattgcattttatatacagg |
35465482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 164 - 210
Target Start/End: Complemental strand, 48615542 - 48615496
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
48615542 |
cccgtgagcataactcagttggtagggatattgcatattatatgcag |
48615496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 50512357 - 50512407
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| ||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50512357 |
atccccatgagcttagctcagttggtaggaatattgcatattatatgcagg |
50512407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 52757351 - 52757301
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
52757351 |
atccccgtgagcttagctcagttggcaggaatattgcatattatatgcagg |
52757301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 166 - 211
Target Start/End: Complemental strand, 29771367 - 29771322
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29771367 |
cgtgagcttagctcaattggtagggatattgcatattatatgcagg |
29771322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 174 - 211
Target Start/End: Original strand, 30057232 - 30057269
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30057232 |
tagctcagttggtagggatattgcatattatatgcagg |
30057269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 211
Target Start/End: Complemental strand, 33933811 - 33933762
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
33933811 |
tccccgtgagcttagctcagttggtagggacattgcataatatatgcagg |
33933762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 42231512 - 42231561
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| || ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42231512 |
cccgtgagcttaactcagttggtaggaatattgcatattatatgcaggag |
42231561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 5179955 - 5179903
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||| | || ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5179955 |
atccccgtgaacttaactcagttggtaaggatattgcatattatatgcaggag |
5179903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 209
Target Start/End: Complemental strand, 13264347 - 13264299
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||| ||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
13264347 |
atccccatgagcttcgctcagttggtagggatattgcatattatatgca |
13264299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 16589020 - 16588980
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaaccct |
303 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16589020 |
aaaataacctatattacaggaggtaaaacactattaaccct |
16588980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 217
Target Start/End: Complemental strand, 21380255 - 21380199
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgg |
217 |
Q |
| |
|
||||||||||| ||||||| ||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
21380255 |
atccccgtgagtttagctcaattgctagggatattgcatattataagcaggaggcgg |
21380199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 35207220 - 35207172
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||| || |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35207220 |
ccgtgagcttaactcagttgatagggatattgcatattatatgcaggag |
35207172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 36132226 - 36132278
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||| ||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
36132226 |
atccccgtgagtttagctcaattggtaggaatattgcatattatatgcaggag |
36132278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 205
Target Start/End: Original strand, 42218747 - 42218791
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattata |
205 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
42218747 |
atccccgtgaacttagctcagttggtagggatattgcatattata |
42218791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 205
Target Start/End: Original strand, 48798276 - 48798320
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattata |
205 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
48798276 |
atccccgtgagcttagctcagttggtagggatattgcattttata |
48798320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 53572396 - 53572348
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||| || |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
53572396 |
ccgtgagcttaactcagttgatagggatattgcatattatatgcaggag |
53572348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 174 - 209
Target Start/End: Complemental strand, 627042 - 627007
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
627042 |
tagctcagttggtagggatattgcatattatatgca |
627007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 174 - 213
Target Start/End: Complemental strand, 15064262 - 15064223
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15064262 |
tagctcagttggtaggaatattgcatattatatgcaggag |
15064223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 15604110 - 15604063
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
15604110 |
cccgtgagcttagctcagttggtagggatgttgcattttatatgcagg |
15604063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 20203428 - 20203475
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||| ||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
20203428 |
cgtgagcttagctcatttggtagagatattgcatattatatgcaggag |
20203475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 211
Target Start/End: Complemental strand, 43481113 - 43481062
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||| ||||||||||| |
|
|
| T |
43481113 |
catccccgtgagcttaactcagttggtagggatattgcactttatatgcagg |
43481062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 44312854 - 44312807
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44312854 |
cccgcgagcttagctcagttggtagggatattgcattttatatgcagg |
44312807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 175 - 218
Target Start/End: Original strand, 49056786 - 49056829
Alignment:
| Q |
175 |
agctcagttggtagggatattgcatattatatgcaggaggcgga |
218 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
49056786 |
agctcagttggtagggacattgcatattatatgcaggagccgga |
49056829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 174 - 209
Target Start/End: Original strand, 54534836 - 54534871
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
54534836 |
tagctcagttggtagggatattgcatattatatgca |
54534871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 542883 - 542837
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
542883 |
ccgtgagcttagctcagttgatagggatattgcatattgtatgcagg |
542837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 164 - 210
Target Start/End: Original strand, 4105727 - 4105773
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
4105727 |
cccgtgagcttagctcagttgatagggatattgcattttatatgcag |
4105773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 173 - 211
Target Start/End: Complemental strand, 12775300 - 12775262
Alignment:
| Q |
173 |
gtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12775300 |
gtagctcagttggtagggatattgcattttatatgcagg |
12775262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 18360490 - 18360540
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
18360490 |
atccccgtgagcttagctcagttggtagggatatcacattttatatgcagg |
18360540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 207
Target Start/End: Complemental strand, 31852686 - 31852640
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||| || |||||||||||||| |||||||||||||||| |
|
|
| T |
31852686 |
atccccgtgagcttatctcagttggtagggttattgcatattatatg |
31852640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 36602439 - 36602389
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
36602439 |
atccccgtgagcttagctcagttggtagggatatcacattttatatgcagg |
36602389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 43271786 - 43271740
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| ||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
43271786 |
ccgtgagcttagttcagttgatagggatattgcatattatatgcagg |
43271740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 56088027 - 56087977
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| | ||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
56088027 |
atccccataagcttagctcagttggtagggatattgcattttatatgcagg |
56087977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 177 - 211
Target Start/End: Complemental strand, 56479283 - 56479249
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
56479283 |
ctcagttggtagggatattgcatattatatgcagg |
56479249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 4700998 - 4700961
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4700998 |
tagctcagttggtagggatattgtatattatatgcagg |
4700961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 161 - 218
Target Start/End: Complemental strand, 10042490 - 10042434
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgga |
218 |
Q |
| |
|
|||| ||||||| ||| |||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
10042490 |
atccgcgtgagc-tagttcagttggtagggatattgcatattatatgtaggagtcgga |
10042434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 180 - 213
Target Start/End: Complemental strand, 12582082 - 12582049
Alignment:
| Q |
180 |
agttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
12582082 |
agttggtagggatattgcatattatatgcaggag |
12582049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 161 - 206
Target Start/End: Original strand, 15208519 - 15208564
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
|||||||||||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
15208519 |
atccccgtgagcttaactcagtgggtagggatattgcatattatat |
15208564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 25726378 - 25726337
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
25726378 |
ccgtgggcttagctcagttggtagggatattgcatattatat |
25726337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 162 - 207
Target Start/End: Original strand, 42395225 - 42395270
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||| |||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
42395225 |
tccctgtgagcttagcttagttggtagggatattgcatattatatg |
42395270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 174 - 211
Target Start/End: Original strand, 55021564 - 55021601
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
55021564 |
tagctcagttggtaggaatattgcatattatatgcagg |
55021601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 55055914 - 55055963
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| |||||||||||||||||| | |||||||| |||||||| |
|
|
| T |
55055914 |
tccccgtgagcttagctcagttggtagggacaatgcatattttatgcagg |
55055963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 8848279 - 8848235
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
8848279 |
gtgagcttagttcagttggtagggatattgcatattatatacagg |
8848235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 17815492 - 17815448
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| ||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
17815492 |
gtgagcttagttcagttggtagggatattacatattatatgcagg |
17815448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 164 - 204
Target Start/End: Complemental strand, 24997504 - 24997464
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattat |
204 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
24997504 |
cccgtgagcttagctcagttggtagggatattgcattttat |
24997464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 25175197 - 25175153
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| ||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
25175197 |
gtgagcttagttcagttggtagggatattacatattatatgcagg |
25175153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 161 - 209
Target Start/End: Complemental strand, 50442814 - 50442766
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||| |||||| |||||||||||||||||||| |||||| |||||||| |
|
|
| T |
50442814 |
atccctgtgagcttagctcagttggtagggataatgcataatatatgca |
50442766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 52483249 - 52483198
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| |||||||||||||| ||||| |
|
|
| T |
52483249 |
atccccgtgagcttagctcagttggta-ggatgttgcatattatatgtaggag |
52483198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 161 - 209
Target Start/End: Complemental strand, 53376752 - 53376704
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||||| |||| ||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
53376752 |
atccccgcgagcttagctcaattggtagggatattgcatgttatatgca |
53376704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 53634324 - 53634272
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||| ||||| ||| |||||| |||||||||||||||||||||| |||||| |
|
|
| T |
53634324 |
atccccatgagcttagttcagttcgtagggatattgcatattatatacaggag |
53634272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 182 - 213
Target Start/End: Original strand, 2688114 - 2688145
Alignment:
| Q |
182 |
ttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2688114 |
ttggtagggatattgcatattatatgcaggag |
2688145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 4357878 - 4357925
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||||||| | ||||||||||||||| ||||||| |||||||||| |
|
|
| T |
4357878 |
catccccgtgaacttagctcagttggtagagatattgtatattatatg |
4357925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 13641078 - 13641125
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| |||||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
13641078 |
cccgtgagcatagctcagctggtagggatatcgcattttatatgcagg |
13641125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 207
Target Start/End: Complemental strand, 18424967 - 18424924
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||| | || ||||||||||||||||||||||||||||||| |
|
|
| T |
18424967 |
cccgtgaacttaactcagttggtagggatattgcatattatatg |
18424924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 180 - 211
Target Start/End: Original strand, 19963798 - 19963829
Alignment:
| Q |
180 |
agttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19963798 |
agttggtagggatattgcatattatatgcagg |
19963829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 176 - 207
Target Start/End: Original strand, 31016348 - 31016379
Alignment:
| Q |
176 |
gctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31016348 |
gctcagttggtagggatattgcatattatatg |
31016379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 33530789 - 33530836
Alignment:
| Q |
160 |
catccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||| ||||||| ||||| | |||||||||||||||||||||||||| |
|
|
| T |
33530789 |
catcctcgtgagcttagcttaattggtagggatattgcatattatatg |
33530836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 207
Target Start/End: Complemental strand, 42381183 - 42381140
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||| ||||||| |
|
|
| T |
42381183 |
cccgtgaacttagctcagttggtagggatattgcatgttatatg |
42381140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 2771037 - 2771083
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| |||||||| || || ||||||||||||||||||||||| |
|
|
| T |
2771037 |
ccgtgagcttagctcagctgatatggatattgcatattatatgcagg |
2771083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 3784913 - 3784959
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||| | |||||||| |
|
|
| T |
3784913 |
ccgtgagcttagctcaattggtagggatattgcataatttatgcagg |
3784959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 7657060 - 7657110
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| || ||||||||||| |||| ||| |||||||||||||| |
|
|
| T |
7657060 |
atccccgtgagcttatctcagttggtaaggatgttgtatattatatgcagg |
7657110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 9692956 - 9693006
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgca-tattatatgcagg |
211 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| |||| ||||||||||||| |
|
|
| T |
9692956 |
tccccgtgagcatagctcagttggcagggataatgcattattatatgcagg |
9693006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 10407101 - 10407056
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
10407101 |
gtgagcttagctcagttggtagg-atattgcatattatatgtaggag |
10407056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 211
Target Start/End: Original strand, 12678520 - 12678554
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
12678520 |
ctcagttggtagagatattgcatattatatgcagg |
12678554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 12763753 - 12763803
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| | | ||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
12763753 |
atccccgtaaacttagctcagttgctagggatattgcatattatatacagg |
12763803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 17872084 - 17872134
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||| | ||||||||||||||||||| ||||| |||| |
|
|
| T |
17872084 |
atccccgtgagcttagcttaattggtagggatattgcatagtatatacagg |
17872134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 207
Target Start/End: Complemental strand, 27103170 - 27103128
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||| || ||||| |||||||||||||||||||||||||||| |
|
|
| T |
27103170 |
ccgtgtgcttagcttagttggtagggatattgcatattatatg |
27103128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 27362898 - 27362852
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| || |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
27362898 |
ccgtgagcttaactcagttggtagcgatattacatattatatgcagg |
27362852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 207
Target Start/End: Complemental strand, 29329896 - 29329850
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||| || ||||||| |
|
|
| T |
29329896 |
atccccgtgagcttagctcagttggtaggaatattgtattttatatg |
29329850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 207
Target Start/End: Original strand, 38228438 - 38228480
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
38228438 |
ccgtgagcttagatcagttggtagggatattgcatgttatatg |
38228480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 211
Target Start/End: Original strand, 43905723 - 43905757
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43905723 |
ctcagttggtagggatattgcatgttatatgcagg |
43905757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 46998435 - 46998389
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||| |||||||||||||| | |||||| |||||||||||||||| |
|
|
| T |
46998435 |
gtgagcttagctcagttggtatgaatattgtatattatatgcaggag |
46998389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 47890692 - 47890742
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| | |||||||||||| |||||||||||||||||||||| |
|
|
| T |
47890692 |
atccccgtgagttaaactcagttggtagagatattgcatattatatgcagg |
47890742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 48744205 - 48744255
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48744205 |
atccccatgagcttagctcagttggtagggatataatatattatatgcagg |
48744255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 211
Target Start/End: Complemental strand, 54103621 - 54103587
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
54103621 |
ctcagttgatagggatattgcatattatatgcagg |
54103587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 55531251 - 55531301
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| ||| ||||||||||||| ||||||| |||| ||||||||||| |
|
|
| T |
55531251 |
atccccgtaagcttagctcagttggtggggatatcgcattttatatgcagg |
55531301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 207
Target Start/End: Complemental strand, 56360785 - 56360739
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
56360785 |
atccccgtgaatttagctcagttggtagggatattgcgtattatatg |
56360739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 209
Target Start/End: Original strand, 1439618 - 1439663
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||||| | |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
1439618 |
cccgtgaacttagctcagttggtatggacattgcatattatatgca |
1439663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 207
Target Start/End: Complemental strand, 8144651 - 8144618
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
8144651 |
tagctcagtttgtagggatattgcatattatatg |
8144618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 211
Target Start/End: Original strand, 8282336 - 8282389
Alignment:
| Q |
158 |
gacatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| |||||||| || |||| ||| || ||||||||||||||||||||||| |
|
|
| T |
8282336 |
gacatctccgtgagcttaactcaattgataaggatattgcatattatatgcagg |
8282389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 207
Target Start/End: Original strand, 12267528 - 12267561
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
12267528 |
tagctcagttggtagagatattgcatattatatg |
12267561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 264 - 313
Target Start/End: Complemental strand, 12388123 - 12388075
Alignment:
| Q |
264 |
aaataacctatattacagaaggtaaaacactattaaccctttctcttata |
313 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
12388123 |
aaatgacctatattacagg-ggtaaaacactattaaccctttttcttata |
12388075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 207
Target Start/End: Complemental strand, 19933860 - 19933827
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
19933860 |
tagctcagttggtagggataatgcatattatatg |
19933827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 213
Target Start/End: Original strand, 22819428 - 22819457
Alignment:
| Q |
184 |
ggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
22819428 |
ggtagggatattgcatattatatgcaggag |
22819457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 264 - 305
Target Start/End: Complemental strand, 24675323 - 24675282
Alignment:
| Q |
264 |
aaataacctatattacagaaggtaaaacactattaacccttt |
305 |
Q |
| |
|
||||| |||||||||||| |||||||||| |||||||||||| |
|
|
| T |
24675323 |
aaatagcctatattacaggaggtaaaacaatattaacccttt |
24675282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 26250645 - 26250694
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||||| || ||||||||||||||| |||||||| | |||||||| |
|
|
| T |
26250645 |
tccccgtgagcataactcagttggtagggacattgcataatttatgcagg |
26250694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 161 - 206
Target Start/End: Complemental strand, 37700672 - 37700627
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
||||||||||| || ||| |||||||||||||||||||||||||| |
|
|
| T |
37700672 |
atccccgtgagtttacctcggttggtagggatattgcatattatat |
37700627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Complemental strand, 40450298 - 40450257
Alignment:
| Q |
262 |
aaaaataacctatattacagaaggtaaaacactattaaccct |
303 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
40450298 |
aaaaataacctatattacagggggtaaaacaccattaaccct |
40450257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 168 - 209
Target Start/End: Complemental strand, 42134523 - 42134482
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
||||| || ||||||| ||||||||||||||||||||||||| |
|
|
| T |
42134523 |
tgagcttaactcagttagtagggatattgcatattatatgca |
42134482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 211
Target Start/End: Complemental strand, 44195680 - 44195647
Alignment:
| Q |
178 |
tcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
44195680 |
tcagttggtagggatattgcattttatatgcagg |
44195647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 161 - 218
Target Start/End: Original strand, 45741472 - 45741529
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcgga |
218 |
Q |
| |
|
||||||||||| || |||| |||||||| ||||||||| ||||||||||||| |||| |
|
|
| T |
45741472 |
atccccgtgagtttaactcaattggtaggaatattgcatgttatatgcaggagccgga |
45741529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 211
Target Start/End: Original strand, 46903345 - 46903378
Alignment:
| Q |
178 |
tcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
46903345 |
tcagttggtatggatattgcatattatatgcagg |
46903378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 54443940 - 54443903
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
54443940 |
tagcttaggtggtagggatattgcatattatatgcagg |
54443903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 263 - 302
Target Start/End: Original strand, 14574944 - 14574984
Alignment:
| Q |
263 |
aaaataacctatattacagaagg-taaaacactattaaccc |
302 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
14574944 |
aaaataacctatattacaggaggataaaacactattaaccc |
14574984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 162 - 210
Target Start/End: Complemental strand, 17554598 - 17554550
Alignment:
| Q |
162 |
tccccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||||||| || ||||||||||| |||||||||||| | ||||||| |
|
|
| T |
17554598 |
tccccgtgagcataactcagttggtaaggatattgcataatttatgcag |
17554550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 263 - 303
Target Start/End: Original strand, 19909343 - 19909383
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaaccct |
303 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
19909343 |
aaaatgacctatattacagggggtaaaacactattaaccct |
19909383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 211
Target Start/End: Original strand, 20320456 - 20320488
Alignment:
| Q |
179 |
cagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
20320456 |
cagttggtagggatatcgcatattatatgcagg |
20320488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 209
Target Start/End: Original strand, 21116778 - 21116826
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||||| || |||||||| || | ||||||||||||||||||| |
|
|
| T |
21116778 |
atccccgtgagcttaactcagttgttaagaatattgcatattatatgca |
21116826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 166 - 206
Target Start/End: Original strand, 21432616 - 21432656
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatat |
206 |
Q |
| |
|
||||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
21432616 |
cgtgagcttagttcagttggtagagatattgcatattatat |
21432656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 167 - 207
Target Start/End: Original strand, 23160040 - 23160080
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||| |
|
|
| T |
23160040 |
gtgagcgtagctcagttggtagggacaatgcataatatatg |
23160080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 262 - 302
Target Start/End: Complemental strand, 31592569 - 31592529
Alignment:
| Q |
262 |
aaaaataacctatattacagaaggtaaaacactattaaccc |
302 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
31592569 |
aaaaataacctatattacagggggtaaaacaccattaaccc |
31592529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 263 - 299
Target Start/End: Complemental strand, 31856932 - 31856896
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaa |
299 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
31856932 |
aaaatgacctatattacagagggtaaaacactattaa |
31856896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 177 - 209
Target Start/End: Original strand, 32339337 - 32339369
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
32339337 |
ctcagttgttagggatattgcatattatatgca |
32339369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 46206580 - 46206624
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
46206580 |
gtgagcttagctcagttggtagggacattgcattatatatgcagg |
46206624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 48825891 - 48825839
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||| | || ||||||||||||| |
|
|
| T |
48825891 |
atccccgtgagcttaactcaattggtagggatatcgaattttatatgcaggag |
48825839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 163 - 211
Target Start/End: Original strand, 51890796 - 51890844
Alignment:
| Q |
163 |
ccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| |||||||||||| ||||| |||||||| | |||||||| |
|
|
| T |
51890796 |
ccccgtgagcttagctcagttggcagggacattgcataatttatgcagg |
51890844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 262 - 302
Target Start/End: Complemental strand, 51902086 - 51902046
Alignment:
| Q |
262 |
aaaaataacctatattacagaaggtaaaacactattaaccc |
302 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
51902086 |
aaaaataacctatattacagggggtaaaacaccattaaccc |
51902046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0707 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: scaffold0707
Description:
Target: scaffold0707; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 93 - 41
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
93 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
41 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 17617 - 17669
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17617 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
17669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 49; Significance: 5e-19; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 59780 - 59832
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
59780 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
59832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 83626 - 83674
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||| |||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
83626 |
ccgtgagtttagctcagttatttgggatattgcatattatatgcaggag |
83674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 266770 - 266718
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
266770 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
266718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 47; Significance: 8e-18; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 46523 - 46573
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46523 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
46573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 11991 - 12043
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||| ||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11991 |
atcctcgtgaacttagctcagttggtagggatattgcatattatatgcaggag |
12043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 10899 - 10849
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10899 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
10849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 930 - 881
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
930 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 112105 - 112157
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
112105 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggag |
112157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0275 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0275
Description:
Target: scaffold0275; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 8818 - 8868
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8818 |
atccccgtgagcttagctcagttggtagggatattgcattttatatgcagg |
8868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 164 - 214
Target Start/End: Complemental strand, 12331 - 12281
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggagg |
214 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12331 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcatgagg |
12281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 8898 - 8848
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8898 |
atccccgtgagcttagctcagttggtagggatattgcatattttatgcagg |
8848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0690 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0690
Description:
Target: scaffold0690; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 164 - 212
Target Start/End: Original strand, 3666 - 3714
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagga |
212 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3666 |
cccgtgagcttaactcagttggtagggatattgcatattatatgcagga |
3714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0288 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 163 - 211
Target Start/End: Original strand, 21263 - 21311
Alignment:
| Q |
163 |
ccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21263 |
ccccgtgagcttagcttagttggtagggatattgcatattatatgcagg |
21311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0157 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0157
Description:
Target: scaffold0157; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 15761 - 15813
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||| ||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15761 |
atcctcgtgagcttatctcagttggtagggatattgcatattatatgcaggag |
15813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 37487 - 37435
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||| ||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37487 |
atcctcgtgagcttaactcagttggtagggatattgcatattatatgcaggag |
37435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 164 - 210
Target Start/End: Original strand, 23361 - 23407
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||| | || |||||||||||||||||||||||||||||||||| |
|
|
| T |
23361 |
cccgtgaacttaactcagttggtagggatattgcatattatatgcag |
23407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 174 - 213
Target Start/End: Complemental strand, 11180 - 11141
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11180 |
tagctcagttggtagggatattgcatattatatgcaggag |
11141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 174 - 213
Target Start/End: Complemental strand, 21508 - 21469
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21508 |
tagctcagttggtagggatattgcatattatatgcaggag |
21469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0100 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 161 - 204
Target Start/End: Original strand, 45881 - 45924
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattat |
204 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45881 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
45924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1372 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold1372
Description:
Target: scaffold1372; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 174 - 211
Target Start/End: Original strand, 1874 - 1911
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1874 |
tagctcagttggtagggatattgcatattatatgcagg |
1911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 167 - 207
Target Start/End: Complemental strand, 65854 - 65814
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
65854 |
gtgagcttagctcagttggtagggatattgcatattatatg |
65814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1787 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold1787
Description:
Target: scaffold1787; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 397 - 447
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| | ||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
397 |
atccccgtgaacttagctcaattgatagggatattgcatattatatgcagg |
447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: scaffold0864
Description:
Target: scaffold0864; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 3660 - 3614
Alignment:
| Q |
167 |
gtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
3660 |
gtgagcttagctcagttggtagggatatttcatattatatgccggag |
3614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 3700 - 3663
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
3700 |
tagcttagttggtaaggatattgcatattatatgcagg |
3663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 28003 - 27953
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||| ||||||| |||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
28003 |
atcctcgtgagcttagctcggttggtagggatattgcattttatatgcagg |
27953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 315646 - 315696
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||| | |||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
315646 |
atccccgtgaacttagctcagttggtaaggatattgcattttatatgcagg |
315696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0394 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0394
Description:
Target: scaffold0394; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 1262 - 1311
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| || ||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
1262 |
cccgtgagcttaactcagttggtaggaatattgtatattatatgcaggag |
1311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0258
Description:
Target: scaffold0258; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 263 - 304
Target Start/End: Complemental strand, 18682 - 18641
Alignment:
| Q |
263 |
aaaataacctatattacagaaggtaaaacactattaaccctt |
304 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18682 |
aaaatgacctatattacaggaggtaaaacactattaaccctt |
18641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0254 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0254
Description:
Target: scaffold0254; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 1317 - 1366
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||| || ||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
1317 |
cccgtgagcttaactcagttggtaggaatattgtatattatatgcaggag |
1366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0330 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0330
Description:
Target: scaffold0330; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 177 - 213
Target Start/End: Original strand, 6781 - 6817
Alignment:
| Q |
177 |
ctcagttggtagggatattgcatattatatgcaggag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6781 |
ctcagttggtagggatattgcatattatatgtaggag |
6817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0199 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0199
Description:
Target: scaffold0199; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 210
Target Start/End: Complemental strand, 8984 - 8940
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcag |
210 |
Q |
| |
|
||||||| || |||| ||||||||||||||||||||||||||||| |
|
|
| T |
8984 |
cgtgagcataactcaattggtagggatattgcatattatatgcag |
8940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 207
Target Start/End: Original strand, 5981 - 6025
Alignment:
| Q |
163 |
ccccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
|||||||||| ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
5981 |
ccccgtgagcttagctcatttgatagggatattgcatattatatg |
6025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1709 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold1709
Description:
Target: scaffold1709; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 168 - 211
Target Start/End: Original strand, 175 - 218
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
175 |
tgagcttagctcagttggtatagatattgcatattatatgcagg |
218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1331 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold1331
Description:
Target: scaffold1331; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 168 - 211
Target Start/End: Complemental strand, 146 - 103
Alignment:
| Q |
168 |
tgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
146 |
tgagcttagctcagttggtatagatattgcatattatatgcagg |
103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0063 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0063
Description:
Target: scaffold0063; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 56323 - 56370
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||||| || |||| |||| ||||||||||||||||||||||||| |
|
|
| T |
56323 |
cccgtgagcttaactcaattggcagggatattgcatattatatgcagg |
56370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 164 - 207
Target Start/End: Complemental strand, 50071 - 50028
Alignment:
| Q |
164 |
cccgtgagcgtagctcagttggtagggatattgcatattatatg |
207 |
Q |
| |
|
||||||||| || |||||||| |||||||||||||||||||||| |
|
|
| T |
50071 |
cccgtgagcttaactcagttgatagggatattgcatattatatg |
50028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 161 - 204
Target Start/End: Complemental strand, 236428 - 236385
Alignment:
| Q |
161 |
atccccgtgagcgtagctcagttggtagggatattgcatattat |
204 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
236428 |
atccccgtgagattagttcagttggtagggatattgcatattat |
236385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 174 - 209
Target Start/End: Original strand, 510966 - 511001
Alignment:
| Q |
174 |
tagctcagttggtagggatattgcatattatatgca |
209 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
510966 |
tagctcagttagtagggatattgcatattatatgca |
511001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 15006 - 15052
Alignment:
| Q |
165 |
ccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||| | |||||||| |
|
|
| T |
15006 |
ccgtgagcttagctcagttggtagggacattgcataatttatgcagg |
15052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 211
Target Start/End: Complemental strand, 59243 - 59201
Alignment:
| Q |
169 |
gagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
59243 |
gagcttagttcagttggtagagatattgcatattatatgcagg |
59201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0517 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0517
Description:
Target: scaffold0517; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 4883 - 4928
Alignment:
| Q |
166 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
||||||| | |||||||| |||||||||||||||| |||||||||| |
|
|
| T |
4883 |
cgtgagcttggctcagttagtagggatattgcataatatatgcagg |
4928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 211
Target Start/End: Original strand, 39664 - 39693
Alignment:
| Q |
182 |
ttggtagggatattgcatattatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39664 |
ttggtagggatattgcatattatatgcagg |
39693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 263 - 302
Target Start/End: Complemental strand, 242431 - 242391
Alignment:
| Q |
263 |
aaaataacctatattacagaagg-taaaacactattaaccc |
302 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
242431 |
aaaataacctatattacaggaggataaaacactattaaccc |
242391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University