View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4520_high_7 (Length: 368)
Name: NF4520_high_7
Description: NF4520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4520_high_7 |
 |  |
|
| [»] scaffold0200 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0200 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: scaffold0200
Description:
Target: scaffold0200; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 11 - 348
Target Start/End: Complemental strand, 28958 - 28621
Alignment:
| Q |
11 |
caaaggcatggagaggagatgttcgagaaactaccggaaacggtgtaaatttcttctatgatggacaaggtttcatgtctgttcaattgactagaacaga |
110 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28958 |
caaaggcatggagaggagacgttcgagaaactaccggaaacggtgtaaatttcttctatgatggacaaggtttcatgtctgttcaattgactagaacaga |
28859 |
T |
 |
| Q |
111 |
tgcaaacattgtgttctatgatgtttctggccaggttttgcacaaaaccacttcatcaaagcagctacattcttccatataaagttcagaacatgtataa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28858 |
tgcaaacattgtgttctatgatgtttctggccaggttttgcacaaaaccacttcatcaaagcagctacattcttccatataaagttcagaacatgtataa |
28759 |
T |
 |
| Q |
211 |
gatcgatagaaagaaaatgagattaaaaaggttttggggactataggattggttttcaaattcaagtcaccaattcttgaatacattactataagttgta |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28758 |
gatcgatagaaagaaaatgagattaaaaaggttttggggactataggattggtttttaaattcaagtcaccaattcttgaatacattactataagttgta |
28659 |
T |
 |
| Q |
311 |
tatatatctctattgcttaggattctcatgatttgaaa |
348 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
28658 |
tatatatttctattgcttaggattttcatgatttgaaa |
28621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University