View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4520_low_14 (Length: 306)
Name: NF4520_low_14
Description: NF4520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4520_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 99; Significance: 7e-49; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 187 - 289
Target Start/End: Complemental strand, 9551946 - 9551844
Alignment:
| Q |
187 |
catactttataacatgaacacctctttgatgaattgaaatactaactatcccaacaacaacacatgacacaaaagaaacacctccaatgactgtgttcaa |
286 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9551946 |
catactttataacatgaacacttctttgatgaattgaaatactaactatcccaacaacaacacatgacacaaaagaaacacctccaatgactgtgttcaa |
9551847 |
T |
|
| Q |
287 |
acc |
289 |
Q |
| |
|
||| |
|
|
| T |
9551846 |
acc |
9551844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 14 - 48
Target Start/End: Complemental strand, 9552119 - 9552085
Alignment:
| Q |
14 |
atcacccttttcataatctttccatttggtagaag |
48 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
9552119 |
atcacccttttcatcatctttccatttggtagaag |
9552085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University