View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4520_low_19 (Length: 251)
Name: NF4520_low_19
Description: NF4520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4520_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 2757598 - 2757366
Alignment:
| Q |
1 |
ctaaagagtagtttttaactttctaccac-aagaagataaagcttcaaaatataattatagcccgaatcaaattatccttcattggtaaccgattgcgta |
99 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2757598 |
ctaaagagtagtttttaactttctaccactaagaagataaagcttcaaaatataattataagccgaatcaaattatccttcattggtaaccgattgcgta |
2757499 |
T |
|
| Q |
100 |
agaaccgccaaataaataaagaaaccttaaaggaacaactttgttcaagacagcctcagaggtgttagattgatcaacctactctacggttgactcgaag |
199 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| | |||||| |||||||||| |||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
2757498 |
agaaccgccaaataaataaagaaacctcaaagggataacttttttcaagacagtctcagaggtgttagattgatcaacttactttacggttgactcgaag |
2757399 |
T |
|
| Q |
200 |
acagttgtagataacgtctatggtagtagagac |
232 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
2757398 |
acagttgtagataacgtttatggtagtagagac |
2757366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 195 - 232
Target Start/End: Complemental strand, 2757337 - 2757300
Alignment:
| Q |
195 |
cgaagacagttgtagataacgtctatggtagtagagac |
232 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
2757337 |
cgaagacggttgtagataatgtctatggtagtagagac |
2757300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University