View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4520_low_20 (Length: 240)
Name: NF4520_low_20
Description: NF4520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4520_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 4819481 - 4819260
Alignment:
| Q |
1 |
ttggtctttggagcttgaaacgccgcaaatttgacttattgggagagcgcggctcggatgagtcagggaaatcacggaatgtgaaatggctgttcaaaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4819481 |
ttggtctttggagcttgaaacgccgcaaatttgacttattgggagagtgtggctcggatgagtcagggaaatcacggaaggtgaaatggctgttcaaaca |
4819382 |
T |
|
| Q |
101 |
ttataaaaaagttggattcctgagggaaaaatcttgacaataaatctttggtcagcaaaattttctaagttggctgccaaaactttcttagcttaaagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4819381 |
ttataaaaaagttggattcctgagggaaaaatcttgacaataaatctttggtcagcaaaattttctaagttggctgccaatactttcttagcttaaagaa |
4819282 |
T |
|
| Q |
201 |
cttcatcaatcaatgaaatgta |
222 |
Q |
| |
|
||||||| |||||||||||||| |
|
|
| T |
4819281 |
cttcatctatcaatgaaatgta |
4819260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 113 - 200
Target Start/End: Complemental strand, 4806890 - 4806803
Alignment:
| Q |
113 |
tggattcctgagggaaaaatcttgacaataaatctttggtcagcaaaattttctaagttggctgccaaaactttcttagcttaaagaa |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||| ||||||| | || |||||||| | ||||| || ||||||| ||| |||||| |
|
|
| T |
4806890 |
tggactcctgagggaaaaatcttgacaacaaatcgttggtcaatagaactttctaagatagctgctaatgctttcttggctcaaagaa |
4806803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University