View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4520_low_21 (Length: 238)
Name: NF4520_low_21
Description: NF4520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4520_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 9 - 223
Target Start/End: Original strand, 36987881 - 36988095
Alignment:
| Q |
9 |
cataggaatgaaagtagttacacaactccatgaattggtttaagataaccaaaagggaatcatttgccacatttattttcatggactaaaatagaaacag |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36987881 |
cataggaatgaaagtagttacacaactccatgaattggtttaagaaaaccaaaagggagtcatttgccacatttattttcatggactaaaatagaaacag |
36987980 |
T |
 |
| Q |
109 |
tttttgaagcaacattccttttcttatagagaaaaagacagtctagaaggaatttcatgccctgatcttgatcacaaatttgacacatagaaagtgcatt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36987981 |
tttttgaagcaacattccttttcttatagagaaaaagacagtctagaaggaatttcatcccctgatcttgatcacaaatttggcacatagaaagtgcatt |
36988080 |
T |
 |
| Q |
209 |
gactaatctttaagt |
223 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
36988081 |
gactaatctttaagt |
36988095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University