View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4521-Insertion-3 (Length: 495)
Name: NF4521-Insertion-3
Description: NF4521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4521-Insertion-3 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 8e-90; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 8e-90
Query Start/End: Original strand, 304 - 495
Target Start/End: Original strand, 6148916 - 6149107
Alignment:
| Q |
304 |
caaacaaaccttgaacataatatacttagaggaaaacagaagggtgtatgtggggcgcgaagttaaagccctaaaaatattttgtctatttaaatttcct |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6148916 |
caaacaaaccttgaacataatatacttagaggaaaacagaagggtgtatgtggggtgtgaagttaaagccctaaaaatattttgtctatttaaatttcct |
6149015 |
T |
|
| Q |
404 |
ttttacatattttctttccaagtagaacgagataagaacaaaggtacgagttaagttaggcaaacccctaattaaaataaattttgttaaag |
495 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
6149016 |
ttttacattttttctttctaagtagaacgagataagaacaaaggtacgagttaagttagacaaacccttaattaaaataaattttgttaaag |
6149107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 173 - 258
Target Start/End: Original strand, 6148785 - 6148870
Alignment:
| Q |
173 |
cttaacagagtccaaccttagagatggattggctttggcttttgggttgtggtgtatatgtgtatgtagaagtgaatacttttgtc |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6148785 |
cttaacagagtccaaccttagagatggattggctttggcttttgggttgtggtgtatatgtgtatgtagaagtgaatacttttgtc |
6148870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 52 - 97
Target Start/End: Original strand, 6148664 - 6148709
Alignment:
| Q |
52 |
ctaatagtaattaatcgaaagaaaatacaacatatcaactgaacag |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6148664 |
ctaatagtaattaatcgaaagaaaatacaacatatcaactgaacag |
6148709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University