View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4521-Insertion-5 (Length: 332)
Name: NF4521-Insertion-5
Description: NF4521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4521-Insertion-5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 8 - 329
Target Start/End: Original strand, 25858049 - 25858369
Alignment:
| Q |
8 |
gatcctactcttgccgagtcttgcggattttagaccaattagaatgtgcaacatttttcacaagactaattctaaggtgcttatctagcgtatcaaacct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25858049 |
gatcctactcttgccgagtcttgcggattttagaccaattagaatgtgcaacatttttcacaagactaattctaaggtgcttatctagcgtatcaaacct |
25858148 |
T |
|
| Q |
108 |
tgcttagattagttcattgactctcttcagacctcttttattcttaacagagatactttttacaatgcaattattgcacaagaagaatgtaagaaaggcc |
207 |
Q |
| |
|
||| ||||||||||||||||| ||||||||| |||||| |||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25858149 |
tgcatagattagttcattgaccctcttcagagctcttt-attcctaacagagatactttttacactgcaattattgcacaagaagaatgtaagaaaggcc |
25858247 |
T |
|
| Q |
208 |
ttttaatgtttaaagtttacttcaagaaagcttatgatagagtgcattgatattttctaaggatgactctttcagaatttggtttcctttctattattat |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25858248 |
ttttaatgtttaaagtttacttcaagaaagcttatgatagagtgcattgatattttctaaggatgactctttcagaatttggtttcccttctattattat |
25858347 |
T |
|
| Q |
308 |
aaatcttatcatgtgttgcatt |
329 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
25858348 |
aaatcttatcatgtgttgcatt |
25858369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University