View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4521_low_3 (Length: 311)
Name: NF4521_low_3
Description: NF4521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4521_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 51 - 211
Target Start/End: Original strand, 6685806 - 6685964
Alignment:
| Q |
51 |
ttggatttgcgttgggtatgtctccgccacaaaggctcaagnnnnnnnnnnacatttgacatttgtgtcgcacataaatccgctgcaaatgtccaaggac |
150 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6685806 |
ttggatttgcgttgggtatggctctgccacaaaggctcaagtttttttt--acatttgacatttgtgtcgcacataaatccgctgcaaatgtccaaggac |
6685903 |
T |
|
| Q |
151 |
attatttcttttttcgttgcaatttacgtcagatctcaacccaccgcaaatcctcaaggat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6685904 |
attatttcttttttcgttgcaatttacgtcagatctcaacccaccgcaaatcctcaaggat |
6685964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University