View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4521_low_7 (Length: 228)
Name: NF4521_low_7
Description: NF4521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4521_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 35 - 209
Target Start/End: Complemental strand, 40323227 - 40323053
Alignment:
| Q |
35 |
agcagagagaataaaaactggaatgccaaacaaaccggaggagcatgccgtcaatgaagcttcattaaagttgtcgatgaagtcaaaataatcagatata |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40323227 |
agcagagagaataaaaactggaatgccaaacaaactggaggagcatgccgtcaatgaagcttcattaaagttgtcgatgaagtcaaaataatcagatata |
40323128 |
T |
|
| Q |
135 |
attgtttgaatggaagtttttctgaactcatcagacagcaaatcaagcgaaaacccttcaatgaacagagccaaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40323127 |
attgtttgaatggaagtttttctgaactcatcagacagcaaatcaagcgaaaacccttcaatgaacagagccaaa |
40323053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University