View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4522-Insertion-10 (Length: 118)
Name: NF4522-Insertion-10
Description: NF4522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4522-Insertion-10 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 2e-56; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 8 - 118
Target Start/End: Original strand, 48384458 - 48384568
Alignment:
| Q |
8 |
gcccattcccaatgcacatgtccattagtgacctagctagctaacagataaaaacgaatccttccaacgacgtcgtttagtgaatgagtgcttttggata |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48384458 |
gcccattcccaatgcacatgtccattagtgacctagctagctaacagataaaaacgaatccttccaacgacgtcgtttagtgaatgagtgcttttggata |
48384557 |
T |
|
| Q |
108 |
caattatttgg |
118 |
Q |
| |
|
||||||||||| |
|
|
| T |
48384558 |
caattatttgg |
48384568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University