View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4522_high_2 (Length: 422)
Name: NF4522_high_2
Description: NF4522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4522_high_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 375; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 375; E-Value: 0
Query Start/End: Original strand, 7 - 405
Target Start/End: Complemental strand, 21145052 - 21144654
Alignment:
| Q |
7 |
ggacatcatcatcactcaacaacgacaactctccccttaaatccacctcttgtacatcttcttttaacctagaaattctctcttacatcgaaccatgctc |
106 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
21145052 |
ggacatcttcatcattcaacaacgacaactctccccttaaatccacctcttgtatatcttcttttaacctagaaattctctcttacatcgaaccatactc |
21144953 |
T |
|
| Q |
107 |
ctccttgttccactctctaagccttcctttaaccccttttagtttctcttttaacacaaatcccatccatcacgttaaatgttgtgaattccacacctcc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21144952 |
ctccttgttccactctctaagccttcctttaaccccttttagtttctcttttaacagaaatcccatccatcacgttaaatgttgtgaattccacacctcc |
21144853 |
T |
|
| Q |
207 |
tcaaccacctctttgatttgcctattatccaaccaatagtgtagattttgattctagccacatccaatatcctccttaaaattgtatcctcatcaaaatc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21144852 |
tcaaccacctctttgatttgcctattatccaaccaatagtgtagattttgattctagccacatccaatatcctccttaaaattgtatcctcatcaaaatc |
21144753 |
T |
|
| Q |
307 |
caagaactcaccaaattggtctccaatctgcttgaaagcctcttcatcccagacatgaactggtaaacttaggattttaatccaaacagttattttgct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21144752 |
caagaactcaccaaattggtctccaatctgcttgaaagcctcttcatcccagacatgaactggtaaacttaggattttaatccaaacagttcttttgct |
21144654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University