View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4522_high_3 (Length: 344)
Name: NF4522_high_3
Description: NF4522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4522_high_3 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 22 - 344
Target Start/End: Original strand, 48763661 - 48763983
Alignment:
| Q |
22 |
ggtggttcactaccgctctcatcatcaatatcctcctcaagaagttgagcagccagagcatacttcttcttccaaaaccaaacctcattccgatgaacaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48763661 |
ggtggttcactaccgctctcatcatcaatatcctcctcaagaagttgagcagccagagcatacttcttcttccaaaaccaaacctcattccgatgaacaa |
48763760 |
T |
|
| Q |
122 |
cctcatcacaaaattttgaaacaggtcaaccaacttgcctaatttcatcttcattccatgttccaattgttcattcatattattatattgttatgtatct |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48763761 |
cctcatcacaaaattttgaaacaggtcaaccaacttgcctaatttcatcttcattccatgttccaattgttcattcatattattatattgttatgtatct |
48763860 |
T |
|
| Q |
222 |
attcgtgttgatcatatctctctaaattgcatctctacaacttgactagggttttggttgggattttttaggtggagtattatttcagtgatttaaactt |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48763861 |
attcgtgttgatcatatctctctaaattgcatctctacaacttgactagggttttggttgggattttttaggtggagtattatttcagcgatttaaactt |
48763960 |
T |
|
| Q |
322 |
ggctaccaccgatcatttgatga |
344 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
48763961 |
ggctaccaccgatcatttgatga |
48763983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University