View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4522_low_5 (Length: 397)
Name: NF4522_low_5
Description: NF4522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4522_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 2e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 15 - 129
Target Start/End: Original strand, 21234708 - 21234822
Alignment:
| Q |
15 |
tcaataaattgtctctcaagtcattcatatccatctgatgcatcctgaccaacaagttgacaataacatttgacaatcttgatgtcacaaacactctcac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21234708 |
tcaataaattgtctctcaagtcattcatattcatctgatgcatcctgaccaacaagttgaaaataacatttgacaatcttgatgtcacaaacactctcac |
21234807 |
T |
 |
| Q |
115 |
taatggcatgcacga |
129 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
21234808 |
taatggcatgcacga |
21234822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University