View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4523_high_10 (Length: 366)

Name: NF4523_high_10
Description: NF4523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4523_high_10
NF4523_high_10
[»] chr5 (2 HSPs)
chr5 (147-335)||(230220-230408)
chr5 (25-66)||(230098-230139)


Alignment Details
Target: chr5 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 147 - 335
Target Start/End: Original strand, 230220 - 230408
Alignment:
147 gggtggaggagaagattgaacaggtggaggggaggcttgaggagtggttgggggtgtattagaaggaggagtgggtggtgctggagatgagtttggggag 246  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
230220 gggtggaggagaagattgaacaggtggaggggaggcttgaggagtggttgggggtgtattagcaggaggagtgggtggtgctggagatgagtttggggag 230319  T
247 gtggatggagcttgttgggctcctacgctggaaaacacaacgcagatcaaaccaattaccaccaaaactatatgatgtgtgcccatctt 335  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
230320 gtggatggagcttgttgggctcctacgctggaaaacacaacgcagatcaaaccaattacaaccaaaactatatgatgtgtgcccatctt 230408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 25 - 66
Target Start/End: Original strand, 230098 - 230139
Alignment:
25 ggaggagtgagtggggttggaggaggagattgctgaacaggt 66  Q
    ||||||||||||||||||||||||||||||||||||||||||    
230098 ggaggagtgagtggggttggaggaggagattgctgaacaggt 230139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University