View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4523_high_22 (Length: 251)

Name: NF4523_high_22
Description: NF4523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4523_high_22
NF4523_high_22
[»] chr7 (2 HSPs)
chr7 (1-239)||(7161028-7161263)
chr7 (97-192)||(3917510-3917605)
[»] chr8 (1 HSPs)
chr8 (154-190)||(3280852-3280888)


Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 7161028 - 7161263
Alignment:
1 tacaacatctcccaccgtttgaacgtcttccattcttgaagtt-attcatttaaatttgcttgatgaattggagtatatgtattatgaaaagctcctttc 99  Q
    ||||| ||||||||||||| ||||||||||||||||||||||| ||||||||||||| |||   | |    |||||||| ||||| |||||||||||||     
7161028 tacaatatctcccaccgttggaacgtcttccattcttgaagtttattcatttaaattcgctccttaa----gagtatatatattacgaaaagctcctttt 7161123  T
100 gcctgaaatattctttccgtctttagagaggctccttttatgcaagtgcaaaaagttgaggggatggtggaggatgggagatgatgtcaatgacaatgat 199  Q
    |||||| ||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||    
7161124 gcctgagatattctttccatctttagagaggctccttttgtgcaagtgcaaaaagttgaggggatggtggaggttgggagctgatgtcaatgacaatgat 7161223  T
200 actgatgactcgtcaaaatcacataatctctccgtccctt 239  Q
    |||||| ||||||||||||||||||||||||| |||||||    
7161224 actgataactcgtcaaaatcacataatctctctgtccctt 7161263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 97 - 192
Target Start/End: Complemental strand, 3917605 - 3917510
Alignment:
97 ttcgcctgaaatattctttccgtctttagagaggctccttttatgcaagtgcaaaaagttgaggggatggtggaggatgggagatgatgtcaatga 192  Q
    ||||||||||| |||||| || | |||| |||| ||| || |||| || ||||| ||||||||||||||||||| |||| | ||||||||||||||    
3917605 ttcgcctgaaacattcttcccatgtttaaagagtctctttatatggaaatgcaataagttgaggggatggtggaagatgagtgatgatgtcaatga 3917510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 3280888 - 3280852
Alignment:
154 gttgaggggatggtggaggatgggagatgatgtcaat 190  Q
    ||||| ||||||||||||||||||||||||| |||||    
3280888 gttgaagggatggtggaggatgggagatgatttcaat 3280852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University