View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4523_high_29 (Length: 218)
Name: NF4523_high_29
Description: NF4523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4523_high_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 16 - 209
Target Start/End: Original strand, 54342939 - 54343134
Alignment:
| Q |
16 |
tgaagatccaaaaagcttttataactcttgcacatgtgttgtaagtacgttgctttgcagataccacaaacaaacatgatg--cagcgcagtttgtaagg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54342939 |
tgaagatccaaaaagcttttataactcttgcacatgtgttgtaggtacgttgctttgcagataccacaaacaaacatgatgtgcagcgcagtttgtaagg |
54343038 |
T |
|
| Q |
114 |
caatcaagattgccaagtgtgccttggagaaactagtgaccgaagttgatccatttggatatgatttagaggttgatgtacattatgcacaggttc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
54343039 |
caatcaagattgccaagtgtgccttggagaaactagtgaccgaagttgatccatttggatatgatttagaggttgatgtacattatgcagaggttc |
54343134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University