View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4523_low_16 (Length: 334)
Name: NF4523_low_16
Description: NF4523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4523_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 16 - 315
Target Start/End: Complemental strand, 55067342 - 55067041
Alignment:
| Q |
16 |
accgtctctttgcatggctgctagattgccaccactcgtagcctttctgcaacctgtttgttccgtttccgccatcgggaacggttgccgctgttgatag |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| | |||||||| |
|
|
| T |
55067342 |
accgcctctttgcatggctgctagattgccaccacttgtagcctttctgcaacctgtttgtttcgtttccgccatcgggaacggttgccaccgttgatag |
55067243 |
T |
|
| Q |
116 |
tcctcattgctttcaccgaagggaagggccttatggtagattgtcctcgttgcaaaatcttccgtctataaattgcagctatttgtcaccgtaacaaccg |
215 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
55067242 |
tcctcattgctttctcc-----gaagggccttatggtagattgtcctcattgcaaaatcttccgtctataaattgcagctatttgtcaccgtaacaactg |
55067148 |
T |
|
| Q |
216 |
cagtgcagagacaatcaatacctctgatatgtttattttcgtct-------ctgtagcactgttttcaaatagtggagaggcaaaatttgctttttgaat |
308 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55067147 |
cagtgcagagacgatcaatacctctgatatgtttattttcgtctctgcagactgcagcactgttttcaaatagtggagaggcaaaatttgctttttgaat |
55067048 |
T |
|
| Q |
309 |
agtgagg |
315 |
Q |
| |
|
||||||| |
|
|
| T |
55067047 |
agtgagg |
55067041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 23 - 77
Target Start/End: Original strand, 30330794 - 30330848
Alignment:
| Q |
23 |
ctttgcatggctgctagattgccaccactcgtagcctttctgcaacctgtttgtt |
77 |
Q |
| |
|
||||| |||||||||||| |||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
30330794 |
ctttggatggctgctagactgccaccacttgtagcctttctgcaatctgtttgtt |
30330848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 262 - 314
Target Start/End: Complemental strand, 51274002 - 51273950
Alignment:
| Q |
262 |
gtagcactgttttcaaatagtggagaggcaaaatttgctttttgaatagtgag |
314 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||| || ||||||||||| |
|
|
| T |
51274002 |
gtagcactgtttccaattagtggagaggcaaaattttctcagtgaatagtgag |
51273950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University