View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4523_low_24 (Length: 280)
Name: NF4523_low_24
Description: NF4523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4523_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 37 - 251
Target Start/End: Complemental strand, 13299820 - 13299605
Alignment:
| Q |
37 |
agcagagatctataatattatttaaatcaacatagatattctaatctaactaagcaccttcttccctttcatccaatacctttctgcttataaaactttc |
136 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13299820 |
agcagtgatctataatattatttaaatcaacatagatattctaatctaactaagcaccttcttccctttcacccaatacctttctgcttataaaactttc |
13299721 |
T |
|
| Q |
137 |
tctttgcatcttacaact--caaaatggaaactcttcttcctgcaccaacaatcactctcactcatctttaatcaatattaaccaagtaagattcttaag |
234 |
Q |
| |
|
|| ||||||||||||||| |||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13299720 |
tc-ttgcatcttacaactcacaaaatggaaactcttcttcctgcaccatcaatcaccctcactcatctttaatcaatattaaccaagtaagattcttaag |
13299622 |
T |
|
| Q |
235 |
cttgtgttttattttca |
251 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
13299621 |
cttgtgttttattttca |
13299605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University