View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4523_low_25 (Length: 271)

Name: NF4523_low_25
Description: NF4523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4523_low_25
NF4523_low_25
[»] chr7 (2 HSPs)
chr7 (198-261)||(32164611-32164674)
chr7 (64-117)||(32164700-32164753)
[»] chr5 (1 HSPs)
chr5 (19-65)||(14729578-14729624)
[»] chr4 (1 HSPs)
chr4 (17-65)||(32488714-32488762)
[»] chr3 (1 HSPs)
chr3 (17-65)||(50710839-50710887)


Alignment Details
Target: chr7 (Bit Score: 52; Significance: 7e-21; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 198 - 261
Target Start/End: Complemental strand, 32164674 - 32164611
Alignment:
Q  198 tttcatccagtcgccatgaggacgacatcatccaatttcaccgataaaattgatatcatctgtg 261  Q
    |||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |||||||||    
T  32164674 tttcatccagtcgccatgaggacgacgtcatccaatttcaccaataaaattgatgtcatctgtg 32164611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 64 - 117
Target Start/End: Complemental strand, 32164753 - 32164700
Alignment:
Q  64 ttatgcaatgatgacgacaaattttgttctcatattaagtgagaatcatgtgat 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  32164753 ttatgcaatgatgacgacaaattttgttctcatattaagtgagaatcacgtgat 32164700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 65
Target Start/End: Original strand, 14729578 - 14729624
Alignment:
Q  19 tttcatatgctcttttagtctttaaatctacgattcttgtctatgtt 65  Q
    |||| |||| |||||||||||||||||||| ||| ||||||||||||    
T  14729578 tttcttatggtcttttagtctttaaatctatgatccttgtctatgtt 14729624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 17 - 65
Target Start/End: Original strand, 32488714 - 32488762
Alignment:
Q  17 attttcatatgctcttttagtctttaaatctacgattcttgtctatgtt 65  Q
    |||||| |||| |||||||||||| ||||||| ||| ||||||||||||    
T  32488714 attttcttatggtcttttagtcttcaaatctatgatccttgtctatgtt 32488762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 17 - 65
Target Start/End: Complemental strand, 50710887 - 50710839
Alignment:
Q  17 attttcatatgctcttttagtctttaaatctacgattcttgtctatgtt 65  Q
    |||||| |||||||||| |||||| ||||||| ||| ||||||||||||    
T  50710887 attttcttatgctctttcagtcttcaaatctatgatccttgtctatgtt 50710839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University