View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4524_low_9 (Length: 239)
Name: NF4524_low_9
Description: NF4524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4524_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 127 - 224
Target Start/End: Complemental strand, 18886456 - 18886362
Alignment:
| Q |
127 |
gtttctttaacatatggcgtgtaaatgttcatcttaagagtttgattttaaatttagtagtatttaatatcatattgtgtatataatgcataagtgag |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18886456 |
gtttctttaacatatggcgtgtaaatgttcatcttaagagtttgattttaaattt---agtatttaatatcatattgtgtacataatgcataagtgag |
18886362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University