View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4525-Insertion-4 (Length: 198)
Name: NF4525-Insertion-4
Description: NF4525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4525-Insertion-4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 2e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 8 - 178
Target Start/End: Original strand, 49583958 - 49584128
Alignment:
| Q |
8 |
aacgtgggcttttgtttcgtctgatgccgaatgtaccggaataagttcaaaatgaattacttgaggtaatgacataaacaatttcaaggtttttcatttt |
107 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49583958 |
aacgtgagcttttgtttcgtctgataccgaatgtaccggaggaagttcaaaatgaattacttgaggtaatgacataaacaatttcaaagtttttcatttt |
49584057 |
T |
|
| Q |
108 |
aatatcgattgttactccgtccactgtcatggattggatctatacttattgatttgtcttccttacttatt |
178 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49584058 |
aatatcgattgttactccgtccattgtcatggattggatctatacttattgatttgtcttccatacttatt |
49584128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University