View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4525_high_4 (Length: 282)
Name: NF4525_high_4
Description: NF4525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4525_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 269
Target Start/End: Complemental strand, 38984646 - 38984404
Alignment:
| Q |
18 |
actattagcatgttgcaacctattcttcttttacctgctgaagcccttttacacaagagcaaaagaagacattccctagcaactaagggtctaaaacttt |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38984646 |
actattagcatgttgcaacctattattcttttacctgctgaagcccttttacacaggagcaaaagaagacattccctgacaactaagggtctaaaacttt |
38984547 |
T |
 |
| Q |
118 |
tggttttgaaataccctttttggaatgggtgatgatgccctctgaatccgctaaatccgcaggattagcttgtgtgatatgttttctctgttgtttagag |
217 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38984546 |
tggttttgaaataccctttttggaacgggtgatgatgccctctgaat---------ccgcaggattagcttgtgtgatatgttttctatgttgtttagag |
38984456 |
T |
 |
| Q |
218 |
accaagacagtgttaacattgtcagagattttaccagcactggacttcccct |
269 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38984455 |
accaagacagtgttagcattgtcagagattttaccagcactggacttcccct |
38984404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 31 - 168
Target Start/End: Complemental strand, 10583059 - 10582923
Alignment:
| Q |
31 |
tgcaacctattcttcttttacctgctgaagcccttttacacaagagcaaaagaagacattccctag-caactaagggtctaaaacttttggttttgaaat |
129 |
Q |
| |
|
|||| ||||||||| |||| |||||||| |||||||||||| |||| || ||||||||||||||| ||||||||| || |||||||||||||| ||||| |
|
|
| T |
10583059 |
tgcagcctattcttttttt--ctgctgaaacccttttacacaggagcgaaggaagacattccctagacaactaaggttccaaaacttttggtttggaaat |
10582962 |
T |
 |
| Q |
130 |
accctttttggaatgggtgatgatgccctctgaatccgc |
168 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
10582961 |
acccattttggaacgggtgatgatgccctctgaatccgc |
10582923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 55 - 231
Target Start/End: Complemental strand, 357011 - 356843
Alignment:
| Q |
55 |
ctgaagcccttttacacaagagcaaaagaagacattccctagc-aactaagggtctaaaacttttggttttgaaataccctttttggaatgggtgatgat |
153 |
Q |
| |
|
||||| |||||||||||| |||| || ||||||||||||||| |||||| | || |||||||||||||| |||||||||| ||||||| ||||| |||| |
|
|
| T |
357011 |
ctgaaacccttttacacaggagcgaaggaagacattccctagataactaatgttccaaaacttttggtttggaaataccctctttggaacgggtgttgat |
356912 |
T |
 |
| Q |
154 |
gccctctgaatccgctaaatccgcaggattagcttgtgtgatatgttttctctgttgtttagagaccaagacagtgtt |
231 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||| |||| | ||| | |||||| |||||||| |
|
|
| T |
356911 |
gccctctgaat---------ccgcatgattagcttgtgtgatatgttttttctgctttttggtgaccaaaacagtgtt |
356843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 51 - 168
Target Start/End: Complemental strand, 16465646 - 16465528
Alignment:
| Q |
51 |
cctgctgaagcccttttacacaagagcaaaagaagacattccctagc-aactaagggtctaaaacttttggttttgaaataccctttttggaatgggtga |
149 |
Q |
| |
|
||||||||| |||||||| |||||| ||||||| |||||| ||||| |||||||| |||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
16465646 |
cctgctgaaacccttttatacaagaacaaaagaggacatttactagccaactaaggttctaaaacttttggttttgaaataccctttttggaacgagtga |
16465547 |
T |
 |
| Q |
150 |
tgatgccctctgaatccgc |
168 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
16465546 |
tgatgccctctgaatccgc |
16465528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 78 - 168
Target Start/End: Original strand, 50249155 - 50249246
Alignment:
| Q |
78 |
aaaagaagacattccctag-caactaagggtctaaaacttttggttttgaaataccctttttggaatgggtgatgatgccctctgaatccgc |
168 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
50249155 |
aaaagaagacattccctagacaactaaggttctaaaacttttggttttgaaataccctttttggaacgggtgatgatgccctttgaatccgc |
50249246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 62; Significance: 8e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 107 - 196
Target Start/End: Original strand, 1265404 - 1265493
Alignment:
| Q |
107 |
tctaaaacttttggttttgaaataccctttttggaatgggtgatgatgccctctgaatccgctaaatccgcaggattagcttgtgtgata |
196 |
Q |
| |
|
||||||||||||||||||| ||| || ||||| ||| |||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
1265404 |
tctaaaacttttggttttgtaatgccgtttttagaacgggtgatgatgccctctgaatccgttgaatccgcaggattagcttgtgtgata |
1265493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 22 - 66
Target Start/End: Original strand, 6762574 - 6762618
Alignment:
| Q |
22 |
ttagcatgttgcaacctattcttcttttacctgctgaagcccttt |
66 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
6762574 |
ttagcttgttgcaacctattcttctttttcctgctgaaacccttt |
6762618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University