View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4525_low_1 (Length: 460)
Name: NF4525_low_1
Description: NF4525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4525_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 1e-85; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 184 - 401
Target Start/End: Complemental strand, 2174099 - 2173890
Alignment:
| Q |
184 |
caaatacaattttctagcccatcctttcgaaagacccctcgcctcgccaagttcaatcaatcttgttggtaaggaatccaacaattatttcaattnnnnn |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2174099 |
caaatacaattttctagcccatcctttcgaaagacccctcgcctcgccaagttcaatcaatcttgttggtaaggaatccaacaattatttcaa------- |
2174007 |
T |
 |
| Q |
284 |
nnttactacctttgatgggggcatggcttcccgcaattgagccaagagctcccaa--ccgcccaccaaagaaggagagaagaagttcctacaaagatgaa |
381 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| | || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2174006 |
--ttactacctttgat-ggggcatggcttcccgcaattgagccaagagctccctaccccccccaccaaagaaggagagaagaagttcctacaaagatgaa |
2173910 |
T |
 |
| Q |
382 |
tgtagattgattttaccaaa |
401 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
2173909 |
tgtagattgattttaccaaa |
2173890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 20 - 157
Target Start/End: Complemental strand, 2174679 - 2174542
Alignment:
| Q |
20 |
ctccagtatgagtgaggaacaccttggtttcgatagccgtcacaaatgattcaaaatcatttcaactcaaacttcctatactttagtgttttaatagcaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2174679 |
ctccagtatgagtgaggaacaccttggtttcgatagcggtcaccaatgattcaaaatcttttcaactcaaacttcctatactttagtgttttaatagcaa |
2174580 |
T |
 |
| Q |
120 |
gatttattttattagaaaaggagaaataaaagtgatac |
157 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2174579 |
gatagattttattagaaaaggagaaataaaagtgatac |
2174542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University