View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4525_low_5 (Length: 322)
Name: NF4525_low_5
Description: NF4525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4525_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 1 - 308
Target Start/End: Original strand, 36170020 - 36170327
Alignment:
| Q |
1 |
ttattgttgttgatgtgagtgatgttgttcatgttcttgttgggtttttgggttctaatgaggtggaaatccaagaagagagtgctaaggttgtttgtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170020 |
ttattgttgttgatgtgagtgatgttgttcatgttcttgttgggtttttgggttctaatgaggtggaaatccaagaagagagtgctaaggttgtttgtgt |
36170119 |
T |
|
| Q |
101 |
tgttgctggttttgattcatataaaggggttttgattagtgctggtgttatcgcgcctttgatccgggttttggattgtgggagtgagttggggaaagtt |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170120 |
tcttgctggttttgattcatataaaggggttttgattagtgctggtgttatcgcgcctttgatccgggttttggattgtgggagtgagttggggaaagtt |
36170219 |
T |
|
| Q |
201 |
gcggctgcgaggtgtttgatgaaattgacggagaattcggataatgcttgggctgtttcggctcatggtggtgtcacggcgttgttgaatatttgtggga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170220 |
gcggctgcgaggtgtttgatgaaattgacggagaattcggataatgcttgggctgtttcggctcatggtggtgtcacggcgttgttgaatatttgtggga |
36170319 |
T |
|
| Q |
301 |
atgatgat |
308 |
Q |
| |
|
|||||||| |
|
|
| T |
36170320 |
atgatgat |
36170327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 6 - 49
Target Start/End: Complemental strand, 3208953 - 3208910
Alignment:
| Q |
6 |
gttgttgatgtgagtgatgttgttcatgttcttgttgggttttt |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3208953 |
gttgttgatgtgagtgatgttgttcatgttcttattgggttttt |
3208910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University