View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4527-Insertion-3 (Length: 332)
Name: NF4527-Insertion-3
Description: NF4527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4527-Insertion-3 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 32 - 332
Target Start/End: Original strand, 25858074 - 25858374
Alignment:
| Q |
32 |
gattttagaccatttagaatgtgcaagatttttcacaagactaattataaggtgcttatctagcgtatcaaaccgtgcttagattagttcattgactctc |
131 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| ||| ||||||||||||||||| ||| |
|
|
| T |
25858074 |
gattttagaccaattagaatgtgcaacatttttcacaagactaattctaaggtgcttatctagcgtatcaaaccttgcatagattagttcattgaccctc |
25858173 |
T |
|
| Q |
132 |
ttc-gacctcttttattcttaacagagatactttttacaatgcaattattgcacaagaagaatgtaagaaaggccttttaatgtttaaagtttacttcag |
230 |
Q |
| |
|
||| || |||||| |||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25858174 |
ttcagagctcttt-attcctaacagagatactttttacactgcaattattgcacaagaagaatgtaagaaaggccttttaatgtttaaagtttacttcaa |
25858272 |
T |
|
| Q |
231 |
gaaagcttatgatatagtgcattgatattttctaaggatgactctttcagaatttggtttcctttctattattataaatcttatcatgtgttgcattgcc |
330 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || |
|
|
| T |
25858273 |
gaaagcttatgatagagtgcattgatattttctaaggatgactctttcagaatttggtttcccttctattattataaatcttatcatgtgttgcatttcc |
25858372 |
T |
|
| Q |
331 |
ta |
332 |
Q |
| |
|
|| |
|
|
| T |
25858373 |
ta |
25858374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University