View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4527-Insertion-4 (Length: 323)
Name: NF4527-Insertion-4
Description: NF4527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4527-Insertion-4 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 8 - 323
Target Start/End: Complemental strand, 5954336 - 5954021
Alignment:
| Q |
8 |
atatggatattatagaccatcacagtaactggttagtacaagtattgcaccagcagggtatttcatttcacattcatcaatacattttctatcattgatt |
107 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5954336 |
atatggatattatagaccagcacagtaactggttagtacaagtattgcaccagcagggtatttcatttcacattcatcaatacattttttatcattgatt |
5954237 |
T |
 |
| Q |
108 |
ctttcttagtgtgagacattgatgtgtttatgtaagcttcaagaatgaagcctagaaatgagtttgaaggttgaagacttttgaagtcttgttatttggt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5954236 |
ctttcttagtgtgagacattgatgtgtttatgtaagcttcaagaatgaagcctagaaatgagtttgaaggttgaagacttttgaagtcttgttatttggt |
5954137 |
T |
 |
| Q |
208 |
aatttattttggcacttttgaagatactggctagtggctactactgtaatacaagttgtgatgcaagtgtttgtcaaacaactccggctttgtttcctac |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
5954136 |
aatttattttggcacttttgaagatactggctagtggctactactgtaatacaagttgtgatgcaagtgtttatcaaacaactccggctttgtttcataa |
5954037 |
T |
 |
| Q |
308 |
ccagctttctttttca |
323 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
5954036 |
ccagctttctttttca |
5954021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University