View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4527-Insertion-5 (Length: 316)
Name: NF4527-Insertion-5
Description: NF4527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4527-Insertion-5 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 71 - 316
Target Start/End: Original strand, 46115745 - 46115990
Alignment:
| Q |
71 |
tacacgatattgattagaaatcacaaacttaattttgaaatcacaatgtcctagcacatttatcaccaatattaattaattagcaatcaaaaacttaatt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46115745 |
tacacgatattgattagaaatcacaaacttaattttgaaatcacaatgtcctagcacatttatcaccaatattaattaattagcaatcaaaaacttaatt |
46115844 |
T |
|
| Q |
171 |
ttgaaattacaaatttctaagactatctataaaaatgtggatgctttgcgcatttagctccgagctaaatagatatctcattgtagagttcatttttggg |
270 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
46115845 |
ttgaaattacaaaattctaagactatctataaaaatgtggatgctttgcgcatttagctccgagctaaatagatatctcattgtagagttcattttttgg |
46115944 |
T |
|
| Q |
271 |
gtgcttatagagatagatgcctataaaaggatcacctctcacttta |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46115945 |
gtgcttatagagatagatgcctataaaaggatcacctctcacttta |
46115990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University