View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4527-Insertion-6 (Length: 204)
Name: NF4527-Insertion-6
Description: NF4527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4527-Insertion-6 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 8 - 204
Target Start/End: Original strand, 32246373 - 32246569
Alignment:
| Q |
8 |
aaagaatagtaaaaagggatgtatatatcatatatgcttctgattctgactatagggacaacaaaaaatgcaactagagataaggattctacaagaaaag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32246373 |
aaagaatagtaaaaagggatgtatatatcatatatgcttctgattctgactatagggacaacaaaaaatgcaactagagataaggattctacaagaaaag |
32246472 |
T |
 |
| Q |
108 |
gtattcatggaaattggaaaatgatctaatcaaaatgcatgcctatagaatgtcaaaaatactattcaactcaataatttaatttgaattctatata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
32246473 |
gtattcatggaaattggaaaatgatctaatcaaaatgcatgcttatagaatgtcaaaaatactattcaactgaataattaaatttgaattctatata |
32246569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University