View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4527_low_4 (Length: 237)
Name: NF4527_low_4
Description: NF4527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4527_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 16 - 182
Target Start/End: Complemental strand, 32869698 - 32869532
Alignment:
| Q |
16 |
atttttagggtaaagagattcgaaagttaagatgccgaattttagcataaaatgccgttttcctattttgccagctctagtaccacagcacattttgccg |
115 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32869698 |
atttttagggtaaagagattcgacagttaagatgccgaattttagcataaaatgccgttttcctattttgccagctccagtaccacagcacattttgccg |
32869599 |
T |
|
| Q |
116 |
tcaaacatgggtttacagtcaatggtgacactattagtggaaaatctactagcacgccccaacaaat |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
32869598 |
tcaaacatgggtttacagtcaatggtgacactattagtggaaaatctactagcacgctccaaaaaat |
32869532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 173 - 237
Target Start/End: Complemental strand, 32868456 - 32868392
Alignment:
| Q |
173 |
cccaacaaatcaatcacttgtattcttttcgtaatttaaatgccaaataaagacactttacgttc |
237 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32868456 |
cccaaaaaatcaatcacttatattcttttcgtaatttaaatgccaaataaagacactttacgttc |
32868392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University