View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4528_low_6 (Length: 254)
Name: NF4528_low_6
Description: NF4528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4528_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 129 - 239
Target Start/End: Complemental strand, 39051936 - 39051822
Alignment:
| Q |
129 |
tagtgaataattgtgatggatacaatatgaaagttaa----agaagaatgtatttgaaaaacaataagaataataattttggtgcgaaagttttagtaca |
224 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
39051936 |
tagtgaataattgtgatggatacgatatgaaagttaagcagagaagaatgtattttaaaaacaataagaataataattttggtgcaagagttttagtaca |
39051837 |
T |
|
| Q |
225 |
acttttgtttttctt |
239 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
39051836 |
acttttgtttttctt |
39051822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University