View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4529-Insertion-10 (Length: 159)
Name: NF4529-Insertion-10
Description: NF4529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4529-Insertion-10 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 76; Significance: 2e-35; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 28 - 159
Target Start/End: Original strand, 32008651 - 32008785
Alignment:
| Q |
28 |
ggatgccattgtttggaattaaaaatccaacgctaatgcagttttagtgaatattatgttttataaatcac-nnnnnnnnattta--tgtttgtataaaa |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| ||||| ||||||| |
|
|
| T |
32008651 |
ggatgccattgtttggaattaaaaatccaacgctaatgcagttttagttaatattatgttttataaatcactttttttttatttatgtgtttatataaaa |
32008750 |
T |
|
| Q |
125 |
tgggtgggtgatacttgaacaacttaaatgttata |
159 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
32008751 |
tgggtgggtgatacttgaacaacagaaatgttata |
32008785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University