View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4529-Insertion-5 (Length: 305)
Name: NF4529-Insertion-5
Description: NF4529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4529-Insertion-5 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 8 - 305
Target Start/End: Complemental strand, 13296233 - 13295938
Alignment:
| Q |
8 |
ctctggtgcgacgccggtggatgtggcggccgcaaatcacgctgaaattccatcctcgcgcggcctgttcaaaagagtaagtggattgggctttgtttat |
107 |
Q |
| |
|
||||||||| |||||||||| | |||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13296233 |
ctctggtgcaacgccggtggctatggcggccgcaaattacgctgaaattccatcctcgcgcgacctgttcaaaagagtaagtggattgggctttgtttat |
13296134 |
T |
|
| Q |
108 |
taaatttgttaaggatacccccacgaaaatttcttatcacacccttcaagcttctcgcgcatccacgnnnnnnnnnnctattttgctcgtgttcggattc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| | || |||||||| |
|
|
| T |
13296133 |
taaatttgttaaggatacccccacgaaaatttcttatcacacccttcaagcttctcgcgcatccacgttttttttttc--tttctattttgctcggattc |
13296036 |
T |
|
| Q |
208 |
tataacccaaaacttagaaatatgttttgagttgtagagtctcaaacatgcaaatataatagacttgcctatccttcattctctaatttctttggtta |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13296035 |
tataacccaaaacttagaaatatgttttgagttgtagagtctcaaacatgcaaatataaaagacttgcctatccttcattctctaatttctttggtta |
13295938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University