View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4529-Insertion-8 (Length: 226)
Name: NF4529-Insertion-8
Description: NF4529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4529-Insertion-8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 33 - 206
Target Start/End: Complemental strand, 40591700 - 40591527
Alignment:
| Q |
33 |
aaactacttaaagtaagaaagagtgagttgaaagagagataatgatacatatagttagttaatctatgcatgacctttaaattatgtacggcatatatgt |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40591700 |
aaactacttaaagtaagaaagagtgagttgaaaaagagatcatgatacatatagttagttaatctatgcatgacctttaaattatgtacggcatatatgt |
40591601 |
T |
|
| Q |
133 |
gtccaaaaaattaccacatgtggttgctttaaggtactcaccagataataataaggatgctgcatctgtggtag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40591600 |
gtccaaaaaattaccacatgtggttgctttaaggtactcaccagataataataaggatgctgcatctgtggtag |
40591527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 35
Target Start/End: Complemental strand, 40591709 - 40591681
Alignment:
| Q |
7 |
aaataatccaaactacttaaagtaagaaa |
35 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40591709 |
aaataatccaaactacttaaagtaagaaa |
40591681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University