View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4529-Insertion-9 (Length: 189)
Name: NF4529-Insertion-9
Description: NF4529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4529-Insertion-9 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 7e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 7e-94
Query Start/End: Original strand, 8 - 189
Target Start/End: Complemental strand, 45668109 - 45667928
Alignment:
| Q |
8 |
caaggtgattagtacaaatctgcggtagattcttctgtgcttcctacaatgatcaaacaaataattctcagcatgccttacaaatgttgcaaccttgtta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45668109 |
caaggtgattagtacaaatctgcggtagattcttctgtgcttcctacaatgatcaaacaaataattctcagcatgccttacaaatgttgcaaccttgtta |
45668010 |
T |
 |
| Q |
108 |
aataacatagccatgaaagaatataaactatttgtaataaattggtatccttgtggttagtgcgcggtacctgcatccctac |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45668009 |
aataacatagccatgaaagaatataaactatttgtaataaattggtttccttgtggttagtgtgcggtacctgcatccctac |
45667928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University