View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4529_high_3 (Length: 361)
Name: NF4529_high_3
Description: NF4529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4529_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 9 - 346
Target Start/End: Complemental strand, 29927126 - 29926789
Alignment:
| Q |
9 |
taatactgtctcaacaatctcttgaatcttgcatcacattgttttctttatagatagatgtactaaaatctgtagtttttctcaattattttttatataa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29927126 |
taatactgtctcaacaatctcttgaatcttgcatcacattgttttctttatagatagatgtgctaaaatctgtagtttttctcaattattttttatgtaa |
29927027 |
T |
|
| Q |
109 |
gtgtcttatgcaaattctttattctttagtgggctagtttgttgttttacttggtacctgacacgagaaagtatttatatgttatcttctttagtatatc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29927026 |
gtgtcttatgcaaattctttattctttagtgggctattttgttgttttacttggtacctgacacgagaaagtatttatatgttatcttctttagtatatc |
29926927 |
T |
|
| Q |
209 |
agctttaaaacaaagatcataattgcttattgtcagccaacttctttctggagaaaaccattttgatgagacaaattataatgaagaaaaaccagatttt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29926926 |
agctttaaaacaaagatcataattgcttattgtcagccaacttctttctggagaaaaccaatttgatgagacaaattataatgaagaaaaaccagatttt |
29926827 |
T |
|
| Q |
309 |
attttgttgaggttagtgaattagttatgcagatgttt |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29926826 |
attttgttgaggttagtgaattagttatgcagatgttt |
29926789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University