View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4529_low_9 (Length: 208)
Name: NF4529_low_9
Description: NF4529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4529_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 19 - 193
Target Start/End: Original strand, 6566469 - 6566643
Alignment:
| Q |
19 |
atgtcgacacccaatttttaagttgtagatattcttatcaaagttgtacctcgtctaggtcataagtttcttgttagcaaattgatgcttcttgataaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6566469 |
atgtcgacacccaatttttaagttgtagatattcttatcaaagttgtacctcgtctaggtcataagtttcttgttagctaattgatgcttcttgataaat |
6566568 |
T |
|
| Q |
119 |
gaagcatatgtataagattttattttggttgataggatttagagatgggattgtcattctcctcttaggtctgtg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
6566569 |
gaagcatatgtataagattttattttggttgataggatttagagatgggattgccattctcctcttaggtttgtg |
6566643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 107
Target Start/End: Complemental strand, 17602994 - 17602932
Alignment:
| Q |
45 |
agatattcttatcaaagttgtacctcgtctaggtcataagtttcttgttagcaaattgatgct |
107 |
Q |
| |
|
||||||||||| ||||||||| || || | | ||||| ||||||||||| ||||||||||||| |
|
|
| T |
17602994 |
agatattcttaccaaagttgttccgcgcccacgtcattagtttcttgttggcaaattgatgct |
17602932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University